Ask Programming Language Expert

Questions:

1. Explain the difference between a compiled language and an interpreted language, which one is Perl?

2. Write a Perl program that prints out all the even numbers from 0 to 20.Print this list 4 times, using while, until, do-until and for loops (so you need to use all 4 loop structures! Just to give you practice in using them). Also make sure to use the % function (don't just add 2!).

3. Write a Perl program that calculates the AT and GC content (i.e. the percentage of G and C, and the percentage of A and T) in a given sequence. You can make up your own dummy sequence and store it as a scalar variable for this question (no need to take it from a file here). Print out the results to a file called DNA_Statistics, the result should look something like this:

The GC content of the DNA sequence give is: 48.5%

The AT content of the DNA sequence give is: 51.5%

Here is a sample DNA sequence for you to use: ‘ACGTAGCGCGTAATAGGCGCCGCGTCAACGCATGACGATCGT'. But your code should work with ANY given DNA sequence! You can declare your sequence as a string in your code, i.e. no need to read it from a file.

4. Write a Perl program that checks if two DNA sequences given as user input are reverse complements to each other.

5. Write a Perl program (call it Ques5A.pl) that takes user entered lines from the keyboard and stores them in an array. When the user enters "quit", the program prints out all the lines sorted (ASCII order - i.e. a line starting with an "Ab..." would print out before one starting with "Ac..."). Now modify the program (call it Ques5B.pl) so it tells you how many lines have been entered, and then prints out only lines 2, 3, and 4.

6. Write a Perl program to read a file, and then print its lines in reverse order, the last line first. Create a dummy file and insert sequences or random text, to test your program with.

7. Ask the user for a list of sequence lengths, separated by whitespace (Example: 100 123 45 ...etc.). The sequence lengths will be stored in a string called $input.

a. Split the String $input and create an array.

b. Use the foreach loop to get the sum of all sequence lengths.

c. Print the average.

8. Write a program, called Convert, that asks a user for a temperature reading in Fahrenheit (F) and then returns the Celsius (C) equivalent, using the following formula:

C = (F - 32) / 1.8

Programming Language, Programming

  • Category:- Programming Language
  • Reference No.:- M91704821
  • Price:- $75

Priced at Now at $75, Verified Solution

Have any Question?


Related Questions in Programming Language

Assignment - haskell program for regular expression

Assignment - Haskell Program for Regular Expression Matching Your assignment is to modify the slowgrep.hs Haskell program presented in class and the online notes, according to the instructions below. You may carry out th ...

Assignment task -q1 a the fibonacci numbers are the numbers

Assignment Task - Q1. (a) The Fibonacci numbers are the numbers in the following integer sequence, called the Fibonacci sequence, and are characterised by the fact that every number after the first two is the sum of the ...

Question - create a microsoft word macro using vba visual

Question - Create a Microsoft Word macro using VBA (Visual Basic for Applications). Name the macro "highlight." The macro should highlight every third line of text in a document. (Imagine creating highlighting that will ...

Assignmentquestion onegiving the following code snippet

Assignment Question One Giving the following code snippet. What kind of errors you will get and how can you correct it. A. public class HelloJava { public static void main(String args[]) { int x=10; int y=2; System.out.p ...

Assignment - proposal literature review research method1

Assignment - Proposal, Literature Review, Research Method 1. Abstract - Summary of the knowledge gap: problems of the existing research - Aim of the research, summary of what this project is to achieve - Summary of the a ...

1 write a function named check that has three parameters

1. Write a function named check () that has three parameters. The first parameter should accept an integer number, andthe second and third parameters should accept a double-precision number. The function body should just ...

Assignment - horse race meetingthe assignment will assess

Assignment - Horse Race Meeting The Assignment will assess competencies for ICTPRG524 Develop high level object-oriented class specifications. Summary The assignment is to design the classes that are necessary for the ad ...

Task silly name testeroverviewcontrol flow allows us to

Task: Silly Name Tester Overview Control flow allows us to alter the order in which our programs execute. Building on our knowledge of variables, we can now use control flow to create programs that perform more than just ...

Structs and enumsoverviewin this task you will create a

Structs and Enums Overview In this task you will create a knight database to help Camelot keep track of all of their knights. Instructions Lets get started. 1. What the topic 5 videos, these will guide you through buildi ...

Task working with arraysoverviewin this task you will

Task: Working with Arrays Overview In this task you will create a simple program which will create and work with an array of strings. This array will then be populated with values, printed out to the console, and then, w ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As