Ask Java Expert


Home >> Java

Problem:

Recombinant DNA molecules are DNA molecules formed by laboratory methods of genetic recombination to bring together genetic material from multiple sources, creating sequences that would not otherwise be found. The letters C, G, A, and T represent nucleotides, the molecules that when joined together, make up the structural units of DNA. Simulate an experiment by searching for the pattern "GAATTC ".  Your code will search for "GAATTC " in the original DNA strand, which is "CTAGAGAATTCCTGA" below. Split that strand into two pieces and place the new DNA, which is "TGATA" below, into the original strand. The new strand should be inserted before the strand being searched for, "GAATTC", to increase the original strand. The user must enter the original strand, the new strand to be inserted, and the sequence to be searched for. Your dialog must look like this, with three inputs and the longer strand as the output:

Original: CTAGAGAATTCCTGA

New: TGATA

Search: GAATTC

Increased: CTAGATGATAGAATTCCTGA

Hints:

  • Assume all inputs are uppercase letters GTAC only. No other letters, no spaces, ...
  • Assume the search string is in the original strand. We will not enter invalid inputs

Java, Programming

  • Category:- Java
  • Reference No.:- M91858091
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Java

Chatbotscreate a small networked chat application that is

Chatbots Create a small, networked chat application that is populated by bots. Introduction On an old server park, filled with applications from the early days of the internet, a few servers still run one of the earliest ...

Assignment taskwrite a java console application that allows

Assignment task Write a java console application that allows the user to read, validate, store, display, sort and search data such as flight departure city (String), flight number (integer), flight distance (integer), fl ...

Assignment game prototypeoverviewfor this assessment task

Assignment: Game Prototype Overview For this assessment task you are expected to construct a prototype level/area as a "proof of concept" for the game that you have designed in Assignment 1. The prototype should function ...

Assignment taskwrite a java console application that allows

Assignment task Write a java console application that allows the user to read, validate, store, display, sort and search data such as flight departure city (String), flight number (integer), flight distance (integer), fl ...

In relation to javaa what is constructor the purpose of

(In relation to Java) A. What is constructor? the purpose of default constructor? B. How do you get a copy of the object but not the reference of the object? C. What are static variables and instance variables? D. Compar ...

Project descriptionwrite a java program to traverse a

Project Description: Write a java program to traverse a directory structure (DirWalker.java) of csv files that contain csv files with customer info. A simple sample in provided in with the sample code but you MUST will r ...

Fundamentals of operating systems and java

Fundamentals of Operating Systems and Java Programming Purpose of the assessment (with ULO Mapping) This assignment assesses the following Unit Learning Outcomes; students should be able to demonstrate their achievements ...

Assessment -java program using array of Assessment -JAVA Program using array of objects

Assessment -JAVA Program using array of objects Objectives This assessment item relates to the course learning outcomes as stated in the Unit Profile. Details For this assignment, you are required to develop a Windowed G ...

Applied software engineering assignment 1 -learning

Applied Software Engineering Assignment 1 - Learning outcomes - 1. Understand the notion of software engineering and why it is important. 2. Analyse the risk factors associated with phases of the software development lif ...

Retail price calculatorwrite a java program that asks the

Retail Price Calculator Write a JAVA program that asks the user to enter an item's wholesale cost and its markup percentage. It should then display the item's retail price. For example: (If an item's wholesale cost is 5. ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As