Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask C/C++ Expert


Home >> C/C++

The DNA molecule employs a 4-element code consisting of sequences of the following nucleotides: Adenine,
Guanine, Cytosine and Thymine. Biologists often use a letter sequence to represent the genome, in which each
letter stands for one of the four nucleotides. For example:

. . . AGTCTATGTATCTCGTT . . .

Individual genes are substrings of a genome delineated by 3-element start and stop codons. Genes begin with
the start codon ATG and end with one of the following 3 stop codons: TAG, TAA or TGA. Note that start codons
can appear anywhere in the string, followed by a series of 3-element codons and ending with a stop codon.
Note that genes are multiples of 3 in length and do not contain any of the triples ATG, TAG, TAA or TGA.

Write a program that will read in a genome and display all the genes in the genome. Your program must do the
following:
• Include a function named genes that will take two arguments: a string containing a DNA sequence
as described above plus an integer reference parameter, and return a dynamically-allocated array of
strings containing all the genes in the DNA sequence. Each string in the array will contain a unique
gene. The number of elements in the array should be exactly equal to the number of genes in the
sequence and the number of genes found should be returned using the function's reference argument.
• Include a main function that will solicit a DNA sequence string from the user, call the genes function
to obtain all the genes in the sequence and print each one on the console display.

[Hint: there are many ways to do this, but you may find it easiest to perform two "passes" of the sequence. A
first pass to determine how many genes there are, and a second to construct the individual gene strings]

Example:
Enter a DNA sequence: TCATGTGCCCAAGCTGACTATGGCCCAATAGCG
Gene 1 TGCCCAAGC
Gene 2 GCCCAA

C/C++, Programming

  • Category:- C/C++
  • Reference No.:- M9454761

Have any Question?


Related Questions in C/C++

Software development fundamentals assignment 1 -details amp

Software Development Fundamentals Assignment 1 - Details & Problems - In this assignment, you are required to answer the short questions, identify error in the code, give output of the code and develop three C# Console P ...

What are the legal requirements with which websites must

What are the legal requirements with which websites must comply in order to meet the needs of persons with disabilities? Why is maximizing accessibility important to everyone?

Assignment word matchingwhats a six-letter word that has an

Assignment: Word Matching What's a six-letter word that has an e as its first, third, and fifth letter? Can you find an anagram of pine grave. Or how about a word that starts and ends with ant (other than ant itself, of ...

Why do researcher drop the ewaste and where does it end

Why do researcher drop the ewaste and where does it end up?

Question 1find the minimum and maximum of a list of numbers

Question: 1. Find the Minimum and Maximum of a List of Numbers: 10 points File: find_min_max.cpp Write a program that reads some number of integers from the user and finds the minimum and maximum numbers in this list. Th ...

There are several ways to calculate the pulse width of a

There are several ways to calculate the pulse width of a digital input signal. One method is to directly read the input pin and another method (more efficient) is to use a timer and pin change interrupt. Function startTi ...

Project - space race part a console Project - Space Race Part A: Console Implementation

Project - Space Race Part A: Console Implementation INTRODUCTION This assignment aims to give you a real problem-solving experience, similar to what you might encounter in the workplace. You have been hired to complete a ...

1 implement the binary search tree bst in c using the node

1. Implement the Binary Search Tree (BST) in C++, using the Node class template provided below. Please read the provided helper methods in class BST, especially for deleteValue(), make sure you get a fully understanding ...

Assign ment - genetic algorithmin this assignment you will

ASSIGN MENT - GENETIC ALGORITHM In this assignment, you will use your C programming skills to build a simple Genetic Algorithm. DESCRIPTION OF THE PROGRAM - CORE REQUIREMENTS - REQ1: Command-line arguments The user of yo ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As