Ask Programming Language Expert

1. Write a Perl program that given a DNA string, prints out the 20 characters upstream of the start codon ATG. That is, given:

$dna = "CCCCATAGAGATAGAGATAGAGAACCCCGCGCGCTCGCATGGGG";

2. Write a Perl subroutine that reads in a file containing two strings on each line, and creates a hash with the first string as key and second string as value. Test your subroutine on a file containingthe following lines (copy the text and paste it in notepad, and then save it). Your code should work with any size file, not just the one given!

color blue
shape round
weight 150
speed fast

3. Write a program that will predict the size of a population of organisms. The program should ask for the starting number of organisms, their average daily population increase (as a percentage), and the number of days they will multiply. For example, a population might begin with two organisms, have an average daily increase of 50 percent, and will be allowed to multiply for seven days. The program should use a loop to display the size of the population for each day. So for the previous example, the output should look like:

Day                        Organisms

-----------------------------

1                              2.0

2                              3.0

3                              4.5

4                              6.75

5                              10.125

6                              15.1875
7                              22.78125

4. Write a Perl program that adds up the numbers in a file and prints out their sum, average, max and min.  Assume that there is one number per line.  Print the average out showing two digits after the decimal point (Hint: look up the printf command).

Test your program with a file containing:

40

10

2

3

4

5. Write a Perl script to compute the average for each column of numbers in a file with the following format:

1 2 3
5 4 6
0 2 4
etc.

6. Write a Perl script to print out the GI numbers from each header in a FASTA file of sequences. Assume that the headers of the form:

>gi|1234567| more info ..

7. Modify the code in the lecture notes (and book) so that it parses the DNASIS restriction enzyme file (see attached - this is just a small sample of the file so you can test your code on) instead of the BIONET file (which was used in the lecture notes and book).

8. Next generation sequencing is used to sequence RNA samples to get accurate measurements of gene expression on a genomic scale. Write a Perl program that parses out the attached sequence read alignment file (6_perianth_A_filtered.SAM) to count how many reads a gene produced (a higher number indicates a gene that is highly expressed). You basically just have to count the number of times a gene ID (like gene29004) occurs in the given sequence. All lines starting with @ are comment lines and should be ignored. Print out the gene ID's and their counts once done. For instance if you find gene29004 mentioned 3 times while gene23457 6 times in the file, the output should be:

Gene ID:                                              Number of reads aligning:

gene29004                                          3
gene23457                                          6

9. Design a Perl program that takes the following DNA sequence file (test_seq.txt - see attached) and mutates it while maintaining the same base pair distribution (i.e. shuffles the base pairs). Once mutated\shuffled, find the similarity between the mutated and original DNA by calculating a score based on the following criteria:

If a purine was mutated to another purine --> -1

If a pyrimidine was mutated to a pyrimidine --> -1

If a purine was mutated to a pyrimidine or vice versa --> -2

If no change occurred --> 0.

Programming Language, Programming

  • Category:- Programming Language
  • Reference No.:- M91376294
  • Price:- $250

Guranteed 48 Hours Delivery, In Price:- $250

Have any Question?


Related Questions in Programming Language

Assignment - haskell program for regular expression

Assignment - Haskell Program for Regular Expression Matching Your assignment is to modify the slowgrep.hs Haskell program presented in class and the online notes, according to the instructions below. You may carry out th ...

Assignment task -q1 a the fibonacci numbers are the numbers

Assignment Task - Q1. (a) The Fibonacci numbers are the numbers in the following integer sequence, called the Fibonacci sequence, and are characterised by the fact that every number after the first two is the sum of the ...

Question - create a microsoft word macro using vba visual

Question - Create a Microsoft Word macro using VBA (Visual Basic for Applications). Name the macro "highlight." The macro should highlight every third line of text in a document. (Imagine creating highlighting that will ...

Assignmentquestion onegiving the following code snippet

Assignment Question One Giving the following code snippet. What kind of errors you will get and how can you correct it. A. public class HelloJava { public static void main(String args[]) { int x=10; int y=2; System.out.p ...

Assignment - proposal literature review research method1

Assignment - Proposal, Literature Review, Research Method 1. Abstract - Summary of the knowledge gap: problems of the existing research - Aim of the research, summary of what this project is to achieve - Summary of the a ...

1 write a function named check that has three parameters

1. Write a function named check () that has three parameters. The first parameter should accept an integer number, andthe second and third parameters should accept a double-precision number. The function body should just ...

Assignment - horse race meetingthe assignment will assess

Assignment - Horse Race Meeting The Assignment will assess competencies for ICTPRG524 Develop high level object-oriented class specifications. Summary The assignment is to design the classes that are necessary for the ad ...

Task silly name testeroverviewcontrol flow allows us to

Task: Silly Name Tester Overview Control flow allows us to alter the order in which our programs execute. Building on our knowledge of variables, we can now use control flow to create programs that perform more than just ...

Structs and enumsoverviewin this task you will create a

Structs and Enums Overview In this task you will create a knight database to help Camelot keep track of all of their knights. Instructions Lets get started. 1. What the topic 5 videos, these will guide you through buildi ...

Task working with arraysoverviewin this task you will

Task: Working with Arrays Overview In this task you will create a simple program which will create and work with an array of strings. This array will then be populated with values, printed out to the console, and then, w ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As