Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Automata & Computation Expert

1.

Let s1 and s2 be two strings of lengths m and n respectively. By de?nition, a superstring of s1 and s2 is one which contains s1 and s2 as substrings. Give a dynamic programming algorithm to compute a shortest superstring of two strings, and analyze its complexity.

Example: If s1 = aaaagatacac and s2 = acacggtttt then the following are all valid superstrings:
{aaaagatacacggtttt, aaaagatacacacggtttt, aaaagatacacacacggtttt}

However, aaaagatacacggtttt is the shortest. Note that the above formulation does not allow any variations (mismatches or gaps) within the overlapping region.

The motivating application for this problem is genome assembly, where the goal is to reconstruct an unknown supersequence by assembling smaller (known) fragments obtained from it.

2. Give a dynamic programming algorithm for the problem of ?nding an optimal local alignment between a string and itself - ie., we wish to ?nd a pair of best aligning substrings within s.

Note that we cannot directly use the Smith-Waterman local alignment algorithm because it will then only output the entire string aligned to itself as its ?nal answer, which is not the answer we want here. We are after a pair of shorter substrings within s. To make this routine more biologically relevant, you can assume that any optimally aligning pair of substrings that your algorithm detects should NOT overlap within the string - i.e., your optimal local alignment should correspond to two substrings s[i1 . . . i2] and s[j1 . . . j2], such that i2 < j1 (without loss of generality).

The motivating application for this problem is to ?nd "genomic repeats", which are repetitive substrings (with a few variations) present in different loci along a long genome.

3.

How will you modify the linear space Hirschberg technique to work for optimal local alignment computation in linear space (both opt. local alignment score & traceback path)? Explain the main steps of your new (modi?ed) algorithm. No need to expand on parts that are identical to the version of the algorithm discussed for global alignment computation in class.

4.

A q-gram1 is de?ned as a string of length q, where q > 0 is a "small" constant (say, q < 10). Given a string s, let Qq s denote the set of all q-grams in s. Given two strings s1 and s2 of lengths m and n respectively, their q-gram distance is the sum of the number of unique q-grams in each - i.e., qd(s1, s2) = |Qq s1\Qq s2 | + |Qq s2\Qq s1

(Note: the pipe symbol '|' in this expression stands for set cardinality - not absolute values; also the \ symbol stands for set difference.)

a) Give an algorithm to compute qd(s1, s2).

b) Derive a tight lower-bound for edit distance between two strings as a function of their q-gram distance.

c) Using the above results, argue how we can save time in practice in the following scenario: we are interesting in knowing the (optimal) edit distance between two strings only if it is below a certain cutoff, say τ . Otherwise, we don't care what is output.

5.

Given a pattern P of length m and a text T of length n, give an algorithm to ?nd and report all occurrences of P in T using the look-up table data-structure. You can assume that n > m > k, where k is the window length used to build the lookup table.

6.

The nested pairing problem:

Let s be a DNA sequence of length n, as illustrated in Figure 1. We de?ne "pairing" as a set of disjoint pairs of indices in s. A pairing is "proper" only if it is one of the following four pairs: {(a, t), (t, a), (c, g), (g, c)}. Any proper pairing becomes a "nested pairing" when the
string index intervals covered by no two pairs overlap. Put another way with reference to the Figure 1, no two edges should criss-cross.
The problem for this question is to ?nd an optimal nested pairing - i.e., a nested pairing with maximum cardinality.

Give an e?cient algorithm to compute an optimal nested pairing using dynamic programming and comment on its runtime and space requirements.

PS: As a reference, my solution for this problem takes O(n3) time.

496_Compute a shortest superstring.png

Figure: Illustration of a nested pairing of a string s of length n. Each pair is shown as an edge connecting those two character locations along the string. Note that the sequence shown s is *not* a circular string, as the start index (1) and end index (n) are clearly marked. It is only shown as circular for ease of illustrating the nested pairing.

Automata & Computation, Computer Science

  • Category:- Automata & Computation
  • Reference No.:- M9131223
  • Price:- $30

Priced at Now at $30, Verified Solution

Have any Question?


Related Questions in Automata & Computation

Iot and data analytics1 analyse the taskanalyse what is

IOT and data analytics 1. Analyse the Task Analyse what is expected of you. This includes careful reading of the assignment task as specified in the Subject Outline. The executive summary of the research project is to be ...

Models of computation assignment -purpose - to improve and

Models of Computation Assignment - Purpose - To improve and consolidate your understanding of regular and context-free languages, finite-state and pushdown automata. To develop skills in analysis and formal reasoning abo ...

Question - design a state machine that will control a

Question - Design a state machine that will control a vending machine. The vending machine has 4 inputs, N, D indicating a nickel or dime was inserted as well as clk and an active high asynchronous reset. The vending mac ...

Regular expressions automatacomputabilitytheory of

Regular expressions, automata/computability/theory of computation How would I go about interpreting regular expressions? For example, how would I interpret the following in English: (0+1)*011 0*1*2* 0^(+)1^(+)2^(+)

Prove or disprove the following proposed inference rules

Prove or disprove the following proposed inference rules for functional dependencies. A proof should be made by using the reflexive, augmentation, transitive, decomposition, union, and pseudotransitive rules. A disproof ...

Question - design a task or function that will check the

Question - Design a task or function that will check the parity of a word for odd parity. The input to the task/function is a 5-bit word called data_in. If the parity of input data_in is not odd increment an error count ...

Prove or disprove the following proposed inference rules

Prove or disprove the following proposed inference rules for functional dependencies. A proof should be made by using the reflexive, augmentation, transitive, decomposition, union, and pseudotransitive rules. A disproof ...

Question 1a digital computer has a memory unit with 16 bits

Question 1: A digital computer has a memory unit with 16 bits per word. The instruction set consists of 122 different operations. All instructions have an operation code part (opcode) and an address part (allowing for on ...

Question 1hoare logic semantics for each of the parts below

Question 1 Hoare Logic Semantics For each of the parts below, justify your answer briefly. 1. For which programs S does {False} S {True} hold? 2. For which programs S does {True} S {False} hold? 3. For which programs S d ...

Models of computation assignment -purpose - to improve and

Models of Computation Assignment - Purpose - To improve and consolidate your understanding of regular and context-free languages, finite-state and pushdown automata. To develop skills in analysis and formal reasoning abo ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As