1. A sequence in FASTA format consists of a header line starting with a ">" sign, followed by a sequence identifier (GenBank Accession number, or clone name), and one or more lines of the sequence itself.

Write a Java program to first prompt the user for a sequence identifier, such as "Enter a clone name

Then prompt for the DNA sequence. The program should print out a FASTA format sequence to the screen. An example output is listed below: 
>bi617a01
GCATGGCGTAAATTGCCCGTACGCTTAA

2. To develop a Java program to prompt the user to enter a piece of DNA sequence in upper case letter (G, C, A, or T). Using a for loop and the charAt() method of the String class to check each character of the entered sequence, and if the sequence contains non-DNA sequence letter(s), print out the sequence and a message says that the DNA sequence entered contains invalid letters. If what entered is a true DNA sequence (with only G, C, A, or T), print out just the sequence.  (2 points)

3. Design a Java program that asks the user to input a series of 10 integers, and then determines and prints the largest integer you entered. Your program should use at least the following three variables:

counter: A counter to count to 10 (i.e, to keep track of how many numbers have been input and to determine when all 10 numbers have been processed).

number: The integer most recently input by the user.

largest: The largest number found so far.