Ask Civil Engineering Expert

1. A sequence in FASTA format consists of a header line starting with a ">" sign, followed by a sequence identifier (GenBank Accession number, or clone name), and one or more lines of the sequence itself.

Write a Java program to first prompt the user for a sequence identifier, such as "Enter a clone name

Then prompt for the DNA sequence. The program should print out a FASTA format sequence to the screen. An example output is listed below: 
>bi617a01
GCATGGCGTAAATTGCCCGTACGCTTAA

2. To develop a Java program to prompt the user to enter a piece of DNA sequence in upper case letter (G, C, A, or T). Using a for loop and the charAt() method of the String class to check each character of the entered sequence, and if the sequence contains non-DNA sequence letter(s), print out the sequence and a message says that the DNA sequence entered contains invalid letters. If what entered is a true DNA sequence (with only G, C, A, or T), print out just the sequence.  (2 points)


3. Design a Java program that asks the user to input a series of 10 integers, and then determines and prints the largest integer you entered. Your program should use at least the following three variables:

counter: A counter to count to 10 (i.e, to keep track of how many numbers have been input and to determine when all 10 numbers have been processed).

number: The integer most recently input by the user.

largest: The largest number found so far.

Civil Engineering, Engineering

  • Category:- Civil Engineering
  • Reference No.:- M91416430

Have any Question?


Related Questions in Civil Engineering

Assignment -ewb design report format - cover page - the as

Assignment - EWB Design Report Format - Cover page - The as EWB project Table of content Introduction about -EWB and CRDT (Cambodian Rural development team) Background about Cambodia - Economic, Weather, People - living ...

Assessment taskpractical investigationinstructions- it is

Assessment Task Practical Investigation Instructions: - It is very important that you read these instructions. - The hardcopy of the Assignment report, with the Assignment cover sheet, should be submitted to the Assignme ...

Task details the client is doing masters in civil

Task Details: The client is doing Masters in Civil Engineering. He needs a Technical Paper on Earthquake pertaining to Geology and Rock Mechanics. There should be a through discussion of Earthquake in relation to the men ...

Aimthis assignment aims to demonstrate the structural

Aim: This assignment aims to demonstrate the structural design requirements of a glazed façade in a multi-storey building. Among other requirements, the glazed façade is required to comply with Australian Standard AS 204 ...

Masonry design assignmentquestion 1 - derivation of seismic

MASONRY DESIGN ASSIGNMENT Question 1 - Derivation of seismic actions on building a) Determine the storey seismic weights (Wi) for each suspended level of the building, hence the seismic weight (Wt) of the entire building ...

Masonry design assignmentquestion 1 - derivation of seismic

MASONRY DESIGN ASSIGNMENT Question 1 - Derivation of seismic actions on building a) Determine the storey seismic weights (Wi) for each suspended level of the building, hence the seismic weight (Wt) of the entire building ...

Aimthis assignment aims to demonstrate the structural

Aim: This assignment aims to demonstrate the structural design requirements of a glazed façade in a multi-storey building. Among other requirements, the glazed façade is required to comply with Australian Standard AS 204 ...

Assignmenta continuous three spans beam with

Assignment A continuous three spans beam with centre-to-centre distance of 6 m supports 150 mm thick one-way slabs as shown below. The beams have clear spans of 8 m, 9 m, and 8 (face-to-face of 400 mm square columns). Th ...

The drainage system of a cantilever wall shown in below

The drainage system of a cantilever wall shown in below figure, became blocked after a heavy rainstorm and the groundwater level, which was originallybelow the base, rose to1.5 (m) below the surface. Determine the stabil ...

Civilyou are provided with bill of quantities prepared

Civil You are provided with bill of quantities prepared separately, priced and submitted by 3 con- tractors (A,B,C found on LMS) in respect of a proposed project (see appendix for drawings). The site is located on Mt. Al ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As