Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Biology Expert

**When answering, if you could provide a resource to backup your answer please**

When designing primers, it is ideal to have a minimum GC content of 40%. What is the percent of GC content for each of the primers designed in Data Table 4? Are the primers considered "ideal" in terms of GC content?  Explain your answer.

Table 4

Primer 1: TAGCTCAAAGGGTACCTCAG

Primer 2: GATTGGAAGGAACTTCTA

Biology, Academics

  • Category:- Biology
  • Reference No.:- M92218832
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Biology

Do polynucleotides make the proteins dna polymerase 1 dna

Do polynucleotides make the proteins DNA polymerase 1, DNA Polymerase 3, Helicase, SSB proteins, ligase and Primase?

Describe at least one significant structural difference

Describe at least one significant structural difference between the human chromosomes and Drosophila Melanogaster chromosomes

What did you determine was the relationship between surface

What did you determine was the relationship between surface tension and the polarity of the liquids you tested?

Is this statement correct or incorrect whymuscle tension in

Is this statement correct or incorrect? Why? Muscle tension in cardiac contractile muscle can be increased by temporal summation.

Question darwin was not the first to consider evolution as

Question: Darwin was not the first to consider evolution as a process but he did come up with the first effective explanation for how it happens. Describe Darwin's theory of evolution by natural selection. Explain how th ...

In summer squash white fruit w is dominant over yellow

In summer squash, white fruit (W) is dominant over yellow fruit (w) and the "disk" fruit shape (D) is dominant over "sphere" shape (d). Determine the genotypes of the parents in the following cases: A. White disk crossed ...

A suspension is formed from uniform particles of solid of

A suspension is formed from uniform particles of solid, of diameter 10 Mm, suspended in a solvent. What is the best description of this system?

You take a small section of leaf and view it underneath a

You take a small section of leaf and view it underneath a microscope. You count 25 stomata. Now you want to calculate how many stomata would be in a leaf the size of a penny. a) Calculate the area of the view of view (A= ...

Diffusion and osmosis questionin your large intestine the

Diffusion and osmosis question In your large intestine, the water from the food you have eaten needs to be kept in the body to prevent dehydration. Therefore the high concentration of water in feces needs to be moved int ...

Igfbp2 rbp4 and factor d post bariatric surgeryigfbp2 what

IGFBP2/ RBP4 and Factor D Post Bariatric Surgery IGFBP2 ( what the normal physiological action in the body? And how it affectedby obesity? andpost bariatric surgery?) RBP4 (what the normal physiological action in the bod ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As