Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Biology Expert

What to do - Given the following piece of double stranded DNA (the two strands below bind together to form a piece of double stranded DNA) design two primers that will amplify the largest piece of DNA possible. 

  • While primers are usually ~20 nucleotides long, please make yours 9 nucleotides long for simplicity.
  • The size of your PCR product is roughly the distance between your two primers. See at the bottom of this question for a hint on how to calculate it. 
  • Remember direction is important! You should indicate on your primer sequence which is the 3' end and which is the 5' end.

5' - AATGTACCGCGTCTAGGCTGCTGATGCTTAGTCCCCCGATGATCGTGTGAAAAAGTAATCGTGCTGA

3' - TTACATGGCGCAGATCCGACGACTACGAATCAGGGGGCTACTAGCACACTTTTTCATTAGCACGACT

Hint: you need to find primers that amplify the largest piece of DNA possible. You can work out the length of your DNA fragment like this.

Highlight where your primers would bind on the DNA strands. In this example I have designed primers that would bind where the sequence is underlined. 

5' - XXXXXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXXXXXXXX

I'm going to replace the underlines with P (for primer) just so you can keep track of where it is.

5' - PPPPXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPPXXX

Now if I've designed my primers correctly and amplify this sequence then I should get a fragment that looks like this 

5' - PPPPXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPP

Notice only the area under the primer and between the two primers is replicated. Your job is to find the largest fragment you can replicate.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M93106457
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Biology

The ch50 assay is a traditional clinical assay that

The CH50 assay is a traditional clinical assay that measures the function of complement components. In a CH50 assay patient blood is drawn and serum separated from it (serum has no cells). Patient serum is mixed with ant ...

Question in portugal employers are not allowed to terminate

Question: In Portugal, employers are not allowed to terminate employees. In Japan, employers are required to measure the waistlines of their employees, and anyone whose waist exceeds the allowed size is put on a diet by ...

Question write a 525- to 700-word paper on the genetic

Question: Write a 525- to 700-word paper on the genetic disorder (Sickle Cell Disease ). Include the following in your paper: Summarize the Chromosomal Theory of Inheritance and how chromosomal abnormalities can lead to ...

Alice wanted to test a experiment alice always chews double

Alice, wanted to test a experiment. Alice always chews double mint gum because she just quit smoking. Someone told Alice that eclipse gum would last longer. So Alice decided to compose an experiment. Which of the two gum ...

Discussion bad blood a case study of the tuskegee syphilis

Discussion Bad Blood: A Case Study of the Tuskegee Syphilis Project. Photo by Department of Health, Education, and Welfare. Public Health Service. Health Services and Mental Health Administration. Center for Disease Cont ...

The current scientific defination of standard temp and

The current scientific defination of standard temp and pressure (STP) is: 0 degrees C and 1.00 bar pressure of a gas, using ideal gas law calculate the volume In L occupied by 1 mol of an ideal gas under these condition( ...

Trace the flow of carbon within the process of

Trace the flow of carbon within the process of photosynthesis. Be sure to include the following terms in your description: Glucose.NADPH,ATP, Calvin cycle, RUBISCO,CO2.

Instructions address each question below as it relates to

Instructions: Address each question below as it relates to the caw study given. A patient was brought to the Emergency Department by ambulance with two arrow wounds. One arrow is still in the patient on the left side; en ...

Assignment 1 create at least a 350-word blog post in

Assignment 1: Create at least a 350-word blog post in Microsoft® Word in response to the following question: Female copperhead snakes have the ability to reproduce both sexually and asexually. In your opinion, which meth ...

Assignment on nutrition - q1 task you need to select 2

Assignment on Nutrition - Q1. Task: You need to select 2 different age groups of your choice. You will need to plan balanced meals with snacks for a day. Once you have laid out the meal plan you need to: Explain why the ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As