Ask Question, Ask an Expert


Ask Biology Expert

Q1) describe the use of the BLAST tool

Q2) What does BLAST do?

Q3) The sequence shown below was isolated from the causative agent of a respiratory infection.:











Use the BLAST search tool to find out what the infectious agent was?

Q3) The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5’ to 3’).

a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga

b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta

c) Forward = ggctcacagcgcgcccggctat
Reverse = tcatttttaaggtgtgcactttta

d) Forward = atagccgggcgcgctgtagcc
Reverse = taaaagtgcacaccttaaaaatga

describe your reasoning

Q4) A pandemic is underway that has infected millions of people worldwide. It is caused by a strain of influenza that has crossed with an avian virus. You must design PCR primers so that reverse transcriptase PCR can be performed to diagnostically test the presence of the virus in patients.
You obtain the following sequence for a gene in the virus. Note that the sequence given below is the same as the mRNA (except that the uridines are shown as thymidines). See the notes below about the ‘polarity’ of RNA viruses.

1 acaaaaacat aatggattcc aacactgtgt caagctttca ggtagactgc tttctttggc
61 atgtccgcaa acgatttgca gaccaagaac tgggtgatgc cccattcctt gaccggcttc
121 gccgagatca gaagtccctg agaggaagag gcaacactct tggtctggac atcgaaacag
181 ctactcgtgc ggggaaacag atagtggagc ggattctgga tgaggaatct gatgaggcgc
241 ttaaaatgcc gacttcacgc tacctaactg acatgactct cgaagaaatg tcaagggact
301 ggttcatgct catgcccaag cagaaagtgg tgggttccct ttgcatcaaa atggaccagg
361 caatgatgga taaaaccgtc atattgaaag caaacttcag tgtgattttt gaccgattag
421 aaaccctaat actgcttaga gctttcacag aagaaggagc aatcgtggga gaaatctcac
481 cattaccttc tcttccagga catactagtg aggatgtcaa aaatgcaatt ggcgtcctca
541 tcggaggact tgaatggaat gataacacag ttagggtctc tgaaactata cagagattcg
601 cttggagaag cagtgatgag ggtgggagac ttccactccc tccaaatcag aaacggaaaa
661 tggcgagaac aattgagtca gaagtttgaa gaaataaggt ggctgattga agaagtacga
721 catagattga aaattacaga aaacagcttc gaacagataa cgtttatgca agccttacaa
781 ctactgcttg aagtggagca agaga

You will use ‘Primer 3’, an online primer design program, to design the primers for your PCR reaction.
Go to the web address Copy the sequence above into the first text box. Click on the button which says ‘Pick Primers’ (NB all settings will be left at default).

a) Copy the sequences of the first pair of primers suggested by primer 3 and paste them below (note that the primer 3 output will give you the FIRST choice above the sequence, and then a series of alternative choices listed as 1-4 below the sequence (you should select the first choice that appears above the sequence).

b) What are the characteristics of the primers in terms of length, GC content, Tm (NB – you can use the Tm find outd by primer 3

c) What is the size of the PCR product you would expect?

d) What is ‘primer dimer’?

e) PCR efficiency can be compromised if the primers form internal secondary structure or if the pair of primers form ‘primer dimers’. Put the sequences into the following ‘oligo calculator’ ( ) and press ‘find out’. Do the primers produce secondary structure (Sec. Str.) or primer dimer?

f) Would you accept this primer pair as suitable for amplifying the influenza strain? describe your reasoning.

g) Design and describe a PCR-based experiment to specifically detect the presence of the flu virus genome in mammalian cells using your primers designed in part a). Remember that the viral genome is based on RNA (see attached sheet on the influenza genome). Include the list of controls you would include to ensure that your results are meaningful. NB When thinking about which primer to use in the ‘RT’ step you should consider whether the forward or reverse primer will anneal to the viral genome and which will anneal to the mRNA copy produced in cells.

h) How could you modify the experiment to distinguish between the viral genomic RNA and the copy RNA that is produced following infection of a cell (NB – the sequence given above is the cRNA sequence, i.e. the copy RNA that can be directly translated into protein)?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M9924

Have any Question? 

Related Questions in Biology

Assignmentinstructions1 discuss the function in detail of

Assignment Instructions: 1. Discuss the function in detail of each of the following RNA polymerase II transcription factors. TFIIB TFIIE TFIIF TFIIH 2. What additional role does one of the subunits of TFIIH have during t ...

Evolutionary biology in the age of genomics- q1

Evolutionary Biology in the age of Genomics- Q1. Phylogenetic trees- You are analyzing sequences sampled from four turtle species (A-D), considering a genomic region that is 75 base pairs long. You observe the following ...

Demonstrate your understanding of the phenotypic expression

Demonstrate your understanding of the phenotypic expression of genes based on modes of inheritance. Explain the evolutionary significance of different modes of inheritance; for example an autosomal dominant allele which ...

1 erythropoietic protoporphyria epp is a defect in heme

1. Erythropoietic Protoporphyria (EPP) is a defect in heme biosynthesis that is inherited with the X-linked dominant allele E. The X-linked recessive allele e does not contribute to EPP. Colon cancer susceptibility is in ...

Organic chemistry1 there is an attachement with 24

Organic Chemistry 1. There is an attachement with 24 molecules. Make three classification based on the function group. 2. Fill out the chart in the attactment. Complete the flowchart for the separation and isolation of: ...

Human biology1describe the chemical digestion that occurs

HUMAN BIOLOGY 1. Describe the chemical digestion that occurs in the mouth (one sentence). 2. What is the difference between a) the pharynx and the larynx and b) the esophagus and the trachea? 3. Cancer patients often get ...

Biology1 a plant with red flowers is crossed with a

Biology 1. A plant with red flowers is crossed with a white-flowered plant of the same species. All the seeds, when grown, produce plants with red flowers. Assuming that the flower color is controlled by a single pair of ...

Assignmentmutations occur when dna is not replicated

Assignment Mutations occur when DNA is not replicated properly. Fortunately, for the most part, cells have a mechanism to correct the mutation or destroy it. Sometimes that mechanism fails and the mutation survives. Spen ...

Mutations can lead to missing or malformed proteins that

Mutations can lead to missing or malformed proteins that can lead to disease. A group of scientists in the United Kingdom have published a paper in the American Journal of Human Genetics stating that the average person h ...

Question 1 in drosophila melanogaster eyeless ey is a

Question 1: In Drosophila melanogaster, eyeless (ey) is a recessive trait in which the eyes are tiny or absent. The ey locus is found on chromosome 4. Monosomy and trisomy for this very small chromosome are compatible wi ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate