Ask Question, Ask an Expert


Ask Biology Expert

Q1) describe the use of the BLAST tool

Q2) What does BLAST do?

Q3) The sequence shown below was isolated from the causative agent of a respiratory infection.:











Use the BLAST search tool to find out what the infectious agent was?

Q3) The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5’ to 3’).

a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga

b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta

c) Forward = ggctcacagcgcgcccggctat
Reverse = tcatttttaaggtgtgcactttta

d) Forward = atagccgggcgcgctgtagcc
Reverse = taaaagtgcacaccttaaaaatga

describe your reasoning

Q4) A pandemic is underway that has infected millions of people worldwide. It is caused by a strain of influenza that has crossed with an avian virus. You must design PCR primers so that reverse transcriptase PCR can be performed to diagnostically test the presence of the virus in patients.
You obtain the following sequence for a gene in the virus. Note that the sequence given below is the same as the mRNA (except that the uridines are shown as thymidines). See the notes below about the ‘polarity’ of RNA viruses.

1 acaaaaacat aatggattcc aacactgtgt caagctttca ggtagactgc tttctttggc
61 atgtccgcaa acgatttgca gaccaagaac tgggtgatgc cccattcctt gaccggcttc
121 gccgagatca gaagtccctg agaggaagag gcaacactct tggtctggac atcgaaacag
181 ctactcgtgc ggggaaacag atagtggagc ggattctgga tgaggaatct gatgaggcgc
241 ttaaaatgcc gacttcacgc tacctaactg acatgactct cgaagaaatg tcaagggact
301 ggttcatgct catgcccaag cagaaagtgg tgggttccct ttgcatcaaa atggaccagg
361 caatgatgga taaaaccgtc atattgaaag caaacttcag tgtgattttt gaccgattag
421 aaaccctaat actgcttaga gctttcacag aagaaggagc aatcgtggga gaaatctcac
481 cattaccttc tcttccagga catactagtg aggatgtcaa aaatgcaatt ggcgtcctca
541 tcggaggact tgaatggaat gataacacag ttagggtctc tgaaactata cagagattcg
601 cttggagaag cagtgatgag ggtgggagac ttccactccc tccaaatcag aaacggaaaa
661 tggcgagaac aattgagtca gaagtttgaa gaaataaggt ggctgattga agaagtacga
721 catagattga aaattacaga aaacagcttc gaacagataa cgtttatgca agccttacaa
781 ctactgcttg aagtggagca agaga

You will use ‘Primer 3’, an online primer design program, to design the primers for your PCR reaction.
Go to the web address Copy the sequence above into the first text box. Click on the button which says ‘Pick Primers’ (NB all settings will be left at default).

a) Copy the sequences of the first pair of primers suggested by primer 3 and paste them below (note that the primer 3 output will give you the FIRST choice above the sequence, and then a series of alternative choices listed as 1-4 below the sequence (you should select the first choice that appears above the sequence).

b) What are the characteristics of the primers in terms of length, GC content, Tm (NB – you can use the Tm find outd by primer 3

c) What is the size of the PCR product you would expect?

d) What is ‘primer dimer’?

e) PCR efficiency can be compromised if the primers form internal secondary structure or if the pair of primers form ‘primer dimers’. Put the sequences into the following ‘oligo calculator’ ( ) and press ‘find out’. Do the primers produce secondary structure (Sec. Str.) or primer dimer?

f) Would you accept this primer pair as suitable for amplifying the influenza strain? describe your reasoning.

g) Design and describe a PCR-based experiment to specifically detect the presence of the flu virus genome in mammalian cells using your primers designed in part a). Remember that the viral genome is based on RNA (see attached sheet on the influenza genome). Include the list of controls you would include to ensure that your results are meaningful. NB When thinking about which primer to use in the ‘RT’ step you should consider whether the forward or reverse primer will anneal to the viral genome and which will anneal to the mRNA copy produced in cells.

h) How could you modify the experiment to distinguish between the viral genomic RNA and the copy RNA that is produced following infection of a cell (NB – the sequence given above is the cRNA sequence, i.e. the copy RNA that can be directly translated into protein)?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M9924

Have any Question? 

Related Questions in Biology

What are the differences between the roles of mainstream

What are the differences between the roles of mainstream and alternative health care providers? Do you feel that these types of health care workers are given the respect as professionals that they deserve? Why, or why no ...

Trace the path of a sperm out of the male body and the path

Trace the path of a sperm out of the male body and the path of a sperm into the female body to an oocyte.

1 define polymerase chain reaction pcr demonstrate one

1. Define polymerase chain reaction (PCR). Demonstrate one cycle of the PCR process starting with one piece of DNA fragment. In the drawing, label template DNA, primers, dNTPs, and DNA polymerase. 2. Compare and contrast ...

1 a portion of a gene contains the following sequence

1. A portion of a gene contains the following sequence: GAAGGAGTAGCA. After transcription, it gives the mRNA sequence: CUUCCUCAUCGU, which is then translated to the amino acid sequence leucine-proline-histidine-arginine. ...

In anotherchapter you will learn of evidence that primates

In anotherchapter, you will learn of evidence that primates, especially fossil species in the Hominin group that apparently led to our currentHomo sapiens sapiensspecies identity. Many of the fossils of pre-human species ...

What are the steps in the process of creating a safe

What are the steps in the process of creating a safe schools/health student initiative?

Why is internalization important for respiration in animals

Why is internalization important for respiration in animals? and what does it mean?

Outline the differences between a special sensory motor and

Outline the differences between a special sensory, motor and mixed cranial nerve, and briefly describe the functions of each sensory component of the cranial nerve What are EPSPs and IPSPs, and how are they produced? Exp ...

Freckles f and six fingers s are dominant alleles in humans

Freckles (F) and six fingers (S) are dominant alleles in humans and the genes occur on different chromosomes. If an FfSs male and an FfSs female have a WHOLE BUNCH of kids, Here are the expected ratios below. 9: freckles ...

The end products of both mitosis and meiosis is a set of

The end products of both mitosis and meiosis is a set of chromosomes. Explain the differences between the two sets. Suppose that Mendel had decided to use dogs for his experiments. What problems would he have had that he ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro