Ask Question, Ask an Expert


Ask Biology Expert

Q1) describe the use of the BLAST tool

Q2) What does BLAST do?

Q3) The sequence shown below was isolated from the causative agent of a respiratory infection.:











Use the BLAST search tool to find out what the infectious agent was?

Q3) The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5’ to 3’).

a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga

b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta

c) Forward = ggctcacagcgcgcccggctat
Reverse = tcatttttaaggtgtgcactttta

d) Forward = atagccgggcgcgctgtagcc
Reverse = taaaagtgcacaccttaaaaatga

describe your reasoning

Q4) A pandemic is underway that has infected millions of people worldwide. It is caused by a strain of influenza that has crossed with an avian virus. You must design PCR primers so that reverse transcriptase PCR can be performed to diagnostically test the presence of the virus in patients.
You obtain the following sequence for a gene in the virus. Note that the sequence given below is the same as the mRNA (except that the uridines are shown as thymidines). See the notes below about the ‘polarity’ of RNA viruses.

1 acaaaaacat aatggattcc aacactgtgt caagctttca ggtagactgc tttctttggc
61 atgtccgcaa acgatttgca gaccaagaac tgggtgatgc cccattcctt gaccggcttc
121 gccgagatca gaagtccctg agaggaagag gcaacactct tggtctggac atcgaaacag
181 ctactcgtgc ggggaaacag atagtggagc ggattctgga tgaggaatct gatgaggcgc
241 ttaaaatgcc gacttcacgc tacctaactg acatgactct cgaagaaatg tcaagggact
301 ggttcatgct catgcccaag cagaaagtgg tgggttccct ttgcatcaaa atggaccagg
361 caatgatgga taaaaccgtc atattgaaag caaacttcag tgtgattttt gaccgattag
421 aaaccctaat actgcttaga gctttcacag aagaaggagc aatcgtggga gaaatctcac
481 cattaccttc tcttccagga catactagtg aggatgtcaa aaatgcaatt ggcgtcctca
541 tcggaggact tgaatggaat gataacacag ttagggtctc tgaaactata cagagattcg
601 cttggagaag cagtgatgag ggtgggagac ttccactccc tccaaatcag aaacggaaaa
661 tggcgagaac aattgagtca gaagtttgaa gaaataaggt ggctgattga agaagtacga
721 catagattga aaattacaga aaacagcttc gaacagataa cgtttatgca agccttacaa
781 ctactgcttg aagtggagca agaga

You will use ‘Primer 3’, an online primer design program, to design the primers for your PCR reaction.
Go to the web address Copy the sequence above into the first text box. Click on the button which says ‘Pick Primers’ (NB all settings will be left at default).

a) Copy the sequences of the first pair of primers suggested by primer 3 and paste them below (note that the primer 3 output will give you the FIRST choice above the sequence, and then a series of alternative choices listed as 1-4 below the sequence (you should select the first choice that appears above the sequence).

b) What are the characteristics of the primers in terms of length, GC content, Tm (NB – you can use the Tm find outd by primer 3

c) What is the size of the PCR product you would expect?

d) What is ‘primer dimer’?

e) PCR efficiency can be compromised if the primers form internal secondary structure or if the pair of primers form ‘primer dimers’. Put the sequences into the following ‘oligo calculator’ ( ) and press ‘find out’. Do the primers produce secondary structure (Sec. Str.) or primer dimer?

f) Would you accept this primer pair as suitable for amplifying the influenza strain? describe your reasoning.

g) Design and describe a PCR-based experiment to specifically detect the presence of the flu virus genome in mammalian cells using your primers designed in part a). Remember that the viral genome is based on RNA (see attached sheet on the influenza genome). Include the list of controls you would include to ensure that your results are meaningful. NB When thinking about which primer to use in the ‘RT’ step you should consider whether the forward or reverse primer will anneal to the viral genome and which will anneal to the mRNA copy produced in cells.

h) How could you modify the experiment to distinguish between the viral genomic RNA and the copy RNA that is produced following infection of a cell (NB – the sequence given above is the cRNA sequence, i.e. the copy RNA that can be directly translated into protein)?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M9924

Have any Question? 

Related Questions in Biology

John has difficulty swallowing loss of taste sensation in

John has difficulty swallowing, loss of taste sensation in the posterior one-third of the right half of his tongue, and decreased salivation, especially on the right side. Describe the sensory portion of the affected neu ...

Explain why type abblood may be called the universal

Explain why type AB+blood may be called the "universal recipient" for blood transfusion. Explain why this would not be true if the transfusion required 6 units( about 3 liters) of blood.

1 define polymerase chain reaction pcr demonstrate one

1. Define polymerase chain reaction (PCR). Demonstrate one cycle of the PCR process starting with one piece of DNA fragment. In the drawing, label template DNA, primers, dNTPs, and DNA polymerase. 2. Compare and contrast ...

Color blindness is an x-linked recessive trait a

Color blindness is an X-linked recessive trait. A color-blind man has a daughter with normal color vision. The daughter marries a man who has normal color vision. What is the expected phenotypic ratio of their children? ...

1 the ductus arteriosus and the ductus venosus are two key

1) The ductus arteriosus and the ductus venosus are two key vessels in the fetal circulation that are absent in the adult circulation. What are their function in the fetus? Why are they necessary? 2) At birth, the fetal ...

What are centennial park nsw sydney australia the water

What are Centennial Park (NSW Sydney Australia) the water cycle management initiatives?(stormwater management, stormwater reuse, water quality monitoring )?

1 explain how insulin regulates glucose levels in the

1. Explain how insulin regulates glucose levels in the blood? 2. What is unique about the glands of the endocrine system?

What policies at the local state or federal level eg

What policies at the local, state or federal level (e.g., education, transportation, employment, etc.) might reduce social and economic inequities? (b) What would a more equitable society look like? (c) Who can make it h ...

Premature infants are prone to respiratory distress

Premature infants are prone to respiratory distress syndrome, which is largely due to surfactant deficiency. Briefly address what surfactant does, and why production is impaired in preterm infants.

Steroid hormones such as testosterone are derived from

Steroid hormones, such as testosterone, are derived from cholesterol. What type of macromolecule are they?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen