What are the 3 methods of genetic transfer sex that, Ask an Expert

Academics

1. What are the 3 methods of genetic transfer (sex) that bacteria can utilize?

2. Explain how the heat-killed type IIIS bacteria in Griffith's experiment genetically altered the live type IIR bacteria.

3. Why does it take more heat to denature a double-strand of DNA with higher G-C content than a double-strand with higher A-T content?

4. What is the complimentary sequence to 5'- ACTTAGCTGCATGCCATAAAA - 3'

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M9467254

Have any Question?Write your Review or question?

Related Questions in Biology

The human microbiome and its relationship to human health

The human microbiome and its relationship to human health, what aspect to the human microbiome is vital?

What is the difference between systole and diastole and how

What is the difference between systole and diastole, and how do they relate to Systolic blood pressure and diastolic blood pressure?

Assignment -the upper-case blue letters are the 14th exon

Assignment - The upper-case, blue letters are the 14th exon (of 20) in the Hephl1 gene in mice. The lower-case (black) letters are from the flanking introns. The highlighted bases indicate primers that may be used to ge ...

A mother has a blood the child has type o mr white has type

A mother has A blood, the child has type O, Mr. White has type B blood, and Mr. Green has AB. Whose the father? Mr. White or Mr. Green; Either Mr. White or Mr. Green; Neither Mr. White or Mr. Green could be the father an ...

Choose one of the areas mentioned above that you would like

Choose ONE of the areas mentioned above that you would like to learn more about and write two or three paragraphs describing the process and how it relates to metabolism within the cell. Provide at least one specific (na ...

Alice wanted to test a experiment alice always chews double

Alice, wanted to test a experiment. Alice always chews double mint gum because she just quit smoking. Someone told Alice that eclipse gum would last longer. So Alice decided to compose an experiment. Which of the two gum ...

Is it possible to increase the temperature of a gas in a

Is it possible to increase the temperature of a gas in a cylinder without any energy addition as heat? Explain your answer using the first law of thermodynamics.

Assignment on nutrition - q1 task you need to select 2

Assignment on Nutrition - Q1. Task: You need to select 2 different age groups of your choice. You will need to plan balanced meals with snacks for a day. Once you have laid out the meal plan you need to: Explain why the ...

The allele for hitchhikers thumb is recessive to the

The allele for hitchhiker's thumb is recessive to the dominant straight thumb. In a population of 500 students, 25% have hitchhiker's thumb. How many students would you expect to be homozygous dominant for the trait?

Discussion bad blood a case study of the tuskegee syphilis

Discussion Bad Blood: A Case Study of the Tuskegee Syphilis Project. Photo by Department of Health, Education, and Welfare. Public Health Service. Health Services and Mental Health Administration. Center for Disease Cont ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert