Using the base pairing of rna to dna the genetic code, Ask an Expert

Academics

Using the base pairing of rna to dna, the genetic code tablerelating to amino acids to mRNA codons, and the one letterabbreviations for the amino acids, decode the following geneticmessage? m RNA is to be transcribed from the entire underlinedsequence.Remember that mRNA usesU in place of T and proeinsynthesisbegins with AUG.

CTGACGTATGGCTAACTATTGTCATATATTGGACCGGGAGAACCGTGCGACCGAAATGGCGACCCATGTGGAACGGTATTGGGAATATTGTAATAGCGTGTA
GACTGCATACCGATTGATAACAGTATATAACCTGGCCCTCTTGGCACGCTGGCTTTACCGCTGGGTACACCTTGCCATAACCCTTAATAACATTATCGCACAT-
mRNA?
protein?
The message??

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M91071708

Have any Question?Write your Review or question?

Related Questions in Biology

Assignment 2 biological basiscontinuing on the research

Assignment 2: Biological Basis Continuing on the research that you started in Week 3, explain what your chosen biotechnology accomplishes and how it is implemented, and describe the body of knowledge that it is based upo ...

Is this statement correct or incorrect whymuscle tension in

Is this statement correct or incorrect? Why? Muscle tension in cardiac contractile muscle can be increased by temporal summation.

Why were there no large mammals around when the dinosaurs

Why were there no large mammals around when the dinosaurs occupied the land?

The allele for hitchhikers thumb is recessive to the

The allele for hitchhiker's thumb is recessive to the dominant straight thumb. In a population of 500 students, 25% have hitchhiker's thumb. How many students would you expect to be homozygous dominant for the trait?

What changes would you expect to see in the liver cells of

What changes would you expect to see in the liver cells of someone suffering from chronic alcoholism?

What is the phenotypic ratio for the offspring of a mother

What is the phenotypic ratio for the offspring of a mother who is homozygous dominant for blonde hair and a blonde-haired father who is heterozygous.

Which are the logical steps proposed by margulis that would

Which are the logical steps proposed by Margulis that would help explain why the accumulation of oxygen in the atmosphere led to the evolution of mitochondria.

Alice wanted to test a experiment alice always chews double

Alice, wanted to test a experiment. Alice always chews double mint gum because she just quit smoking. Someone told Alice that eclipse gum would last longer. So Alice decided to compose an experiment. Which of the two gum ...

Do polynucleotides make the proteins dna polymerase 1 dna

Do polynucleotides make the proteins DNA polymerase 1, DNA Polymerase 3, Helicase, SSB proteins, ligase and Primase?

Discussion board 3 dnaafter reading the prompt below post

Discussion Board 3: DNA After reading the prompt below, post your answer using about 200 words. Post your initial response at least 24 hours prior to the assignment due date, then return to respond to another classmate's ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert