The two sequences below represent a normal and a mutated, Ask an Expert

Academics

The two sequences below represent a normal and a mutated form ofmRNA. Which of the following statements best describes the type of mutation observed?

Normal 5' AUGCCAGCCAGCCCUUCCAGA 3'
Abnormal 5' AUGCCAGCCAGCCCUUCUAGA 3'

a) Point , Silent
b) Point , Missense
c) Point, Nonsense
d) Frame-shift , Insertion
e) Frame-shift, Deletion

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M91067206

Have any Question?Write your Review or question?

Related Questions in Biology

Diffusion and osmosis questionin your large intestine the

Diffusion and osmosis question In your large intestine, the water from the food you have eaten needs to be kept in the body to prevent dehydration. Therefore the high concentration of water in feces needs to be moved int ...

Suppose a man carries a very common dominant mutation for a

Suppose a man carries a very common dominant mutation for a deadly muscular disease that doesn't show up until people are usually over 50 years of age (he has the disease). He and his wife are expecting their first child ...

If you have a bacterial contamination on your plate you

If you have a bacterial contamination on your plate you should not flood it before decontamination or autoclave it could be a chance it spreads more in the work and could be a danger to the environment. For the environme ...

Which are the logical steps proposed by margulis that would

Which are the logical steps proposed by Margulis that would help explain why the accumulation of oxygen in the atmosphere led to the evolution of mitochondria.

What is the process of turning polynucleotides into

What is the process of turning polynucleotides into proteins?

Case study question -case study - mary 21 years old

Case Study Question - Case Study - Mary, 21 years old, presented to the hospital emergency department with an infected laceration on her left foot. Mary was at a beach resort four days ago, when she trod on a broken glas ...

Question - a pure strain of mendels peas dominant for all

Question - A pure strain of mendel's peas, dominant for all seven of his independently assorting genes, was testcrossed. How many different kinds of gametes could the F1 PRODUCE?

Is the iso-osmotic point different for different solutes

Is the iso-osmotic point different for different solutes? Please specify in what ways can the iso-osmotic points be different and why there is a difference.

The ch50 assay is a traditional clinical assay that

The CH50 assay is a traditional clinical assay that measures the function of complement components. In a CH50 assay patient blood is drawn and serum separated from it (serum has no cells). Patient serum is mixed with ant ...

Question 1go outside during daylight hours to a natural or

Question 1. Go outside during daylight hours to a natural or semi-natural space (e.g., Burton's Pond, an urban park, your backyard). Sit still for 20 minutes and closely observe the plants and animals around you. Describ ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert