The sequence for the beta actin gene actb is given below, Ask an Expert

Academics

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').

a) Forward = ggctcacagcgcgcccggctat

Reverse = taaaagtgcacaccttaaaaatga

b) Forward = tatcggcccgcgcgacactcgg

Reverse = tcatttttaaggtgtgcactttta

c) Forward = ggctcacagcgcgcccggctat

Reverse = tcatttttaaggtgtgcactttta

d) Forward = atagccgggcgcgctgtagcc

Reverse = taaaagtgcacaccttaaaaatga

Explain your reasoning

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M9531259

Have any Question?Write your Review or question?

Related Questions in Biology

What is the complementary strand for 5-atgcatgcatgccc-3how

What is the complementary strand for: 5'-ATGCATGCATGCCC-3' How many turn(s) will this strand have? Are Eukaryotic cells always diploid during S phase whereas bacteria are only haploid at the end of DNA replication?

Discussion bad blood a case study of the tuskegee syphilis

Discussion Bad Blood: A Case Study of the Tuskegee Syphilis Project. Photo by Department of Health, Education, and Welfare. Public Health Service. Health Services and Mental Health Administration. Center for Disease Cont ...

Chosen dr jan nolta- stem cell researcher head of uc davis

Chosen Dr. Jan Nolta- Stem Cell Researcher Head of UC Davis Stem Cell Program Director Topic Background: early Stem cells have the ability to develop into many different types of cells. Stem Cell Research is not without ...

Igfbp2 rbp4 and factor d post bariatric surgeryigfbp2 what

IGFBP2/ RBP4 and Factor D Post Bariatric Surgery IGFBP2 ( what the normal physiological action in the body? And how it affectedby obesity? andpost bariatric surgery?) RBP4 (what the normal physiological action in the bod ...

Quesiton synthetic chromosomes transcriptomes and patents

Quesiton: "Synthetic chromosomes, Transcriptomes, and Patents on BRCA genes" For your primary post, please respond to one of the following three topics with a post of at least 125 words that addresses each point given in ...

Diffusion and osmosis questionin your large intestine the

Diffusion and osmosis question In your large intestine, the water from the food you have eaten needs to be kept in the body to prevent dehydration. Therefore the high concentration of water in feces needs to be moved int ...

Describe the form of endocytosis that involves the movement

Describe the form of endocytosis that involves the movement of large amount of liquid into the cell.

What problems does this traditional classification scheme

What problems does this traditional classification scheme of protists create in our understanding of the evolutionary relationships that exist between protists?

Calculate the concentrations at eqbm of h2co3 hco3- co32-

Calculate the concentrations at eqbm of H2CO3, HCO3-, CO32-, and H+ in a saturated aq solution of H2CO3 in which the original concentration of H2CO3 is 0.034M (Ka1= 4.3*10^-7, Ka2 = 4.8*10^-11)

Question choose one of the following topics and write a

Question: Choose one of the following topics and write a 400-500 word essay. You must cite at least 2 primary sources. Follow the proper citation format for articles and or websites. You must use direct (primary) sources ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert