Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

Imagine that you had 11000 of the worlds gross domestic

Imagine that you had 1/1000 of the worlds gross domestic product available at your disposal for conservation biology product? Is it a sound conservation decision to protect just 4% of the earth's living habitat? Why or w ...

Describe how the central nervous system is protected from

Describe how the central nervous system is protected from injury. List the components of a spinal reflex arc. Describe the function of each component.

The splitting of white light into its constituent colours

The splitting of white light into its constituent colours passing through a prism is known as?

With which archaic human species did some of the ancestors

With which archaic human species did some of the ancestors of modern Europeans interbreed during the past 100,000 years?

First present the characteristics of water that make it

First present the characteristics of water that make it capable of hydrogen bonding. Then discuss why water is a good solvent and so readily exhibits capillarity. Finally, examine the heat properties of water, specifical ...

Plants pend towards the source of of light on account of

Plants pend towards the source of of light on account of the movement curvature called?

Cyclin-dependent kinases are special molecules that

Cyclin-dependent kinases are special molecules that facilitate the progression of a cell through the cell cycle. Many molecules such as p53 regulate the cell cycle. An unregulated cell cycle can lead to rapid growth of t ...

Topic genomicsquestion describe how the use of genetic

Topic: Genomics Question: Describe how the use of genetic knowledge can change the course of disease. What are the implications of the prolific use of genetic knowledge for the intervention of disease? Should there be an ...

Lab reportthe purpose of a biology lab report is to

Lab Report The purpose of a Biology lab report is to describe and analyze a laboratory experiment that explores a scientific concept so that other scientists might be able to replicate the experiment and investigate the ...

Lets discuss the role of the intestinal microbiota in the

Let's discuss the role of the intestinal microbiota in the maintenance of health and the many opportunistic pathogens that cause disease when the delicate balance of normal microbiota in this region of the body is distur ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro