Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

Question 1future drugs and vaccines for the use against

Question 1 Future drugs and vaccines for the use against Ebola Pick an experimental drug, vaccine or other treatment that is being considered in the fight against Ebola. http://www.cdc.gov/vhf/ebola/outbreaks/2014-west-a ...

Compare and contrast the respect nature ownership and

Compare and Contrast the "Respect Nature", "Ownership and Control of Environments", and "Landscapes in the Service of Remote Consumers" paradigms. In your response, be certain to include: The effects on the environment o ...

What do we refer as an increase in thickness of ozone layer

What do we refer as an increase in thickness of ozone layer in stratosphere?

To investigate transformer tra gene expression during sex

To investigate transformer (tra) gene expression during sex determination in Drosophila, you perform in situ hybridization (FISH) and immunostaining. Fill in the table with the results you expect to observe following the ...

1 how does the structure of dna double helix determine how

1. How does the structure of DNA (double helix) determine how the genetic information is passed on? 2. How does the cell use the information contained in the DNA to construct proteins (transcription and translation)?

For this assignment you will think about your individual

For this Assignment you will think about your individual health and health risks. What genetic diseases or problems might you face during your lifetime? Predisposition to heart disease, breast cancer, diabetes? You may c ...

Can geneticists accurately predict the possibility of the

Can geneticists accurately predict the possibility of the inheritance of a genetic disease? Why or why not?

1 a portion of a gene contains the following sequence

1. A portion of a gene contains the following sequence: GAAGGAGTAGCA. After transcription, it gives the mRNA sequence: CUUCCUCAUCGU, which is then translated to the amino acid sequence leucine-proline-histidine-arginine. ...

State without explanation any three common features

state without explanation, any three common features regarding reptiles, birds and mammals.

Gene technologygene technology carries with it social and

Gene Technology Gene technology carries with it social and ethical implications-many of which engender personal views and discussion. Select one (1) of the following biotechnology topics to write about:  Genetically modi ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro