Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

What is the difference between cis-acting elements and

What is the difference between cis-acting elements and trans-acting factors in the regulation of DNA?

Reproductive systemdefine primary sex organs secondary sex

Reproductive System Define primary sex organs, secondary sex organs, and secondary sex characteristics Describe the accessory glands and other secondary sex organs of the male/female, and state their functions Explain th ...

The a and b loci are 10 cm apart a plant with a genotype

The A and B loci are 10 cM apart. A plant with a genotype aaBB is crossed to plant with a genotype of AAbb. If an F1 plant is self pollinated, what proportion of the progeny will be homozygous dominant or homozygous rece ...

What is produced by fragmentation of the hyphae into their

What is produced by fragmentation of the hyphae into their component cells?

In a plant the allele that results in violet flowers v is

In a plant, the allele that results in violet flowers (V) is dominant to one that results in white flowers (v); at another locus, the allele that makes prickly seed capsules (P) is dominant to one that results in smooth ...

In the region where your live southeasternga which types of

In the region where your live (Southeastern/GA), which types of ecosystems have experienced the worst degradation and loss? What steps could be taken to restore them?

Familial hypercholesterolemia is associated with increased

Familial hypercholesterolemia is associated with increased riskfor heart attacks at a young age. What kind of clinical test canyou use to test for this disease? What would be the expectedresult? Explain the biochemical p ...

Biology1 what is the difference of fatty acid beta

Biology 1. What is the difference of fatty acid β oxidation in mitochondrion versus peroxisome? Why such a difference exists? 2. (a) Write down the structure of arachidonic acid (C20:4 Δ5,8,11,14). (b) What do you expect ...

Where have you observed an ecosystem change over time how

Where have you observed an ecosystem change over time? How would you describe the biodiversity - in terms of species richness and evenness - of the place and how the change affected biodiversity? What are the positive an ...

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen