Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

Bioethics assignment instructionstopic 2 use of gmo

Bioethics assignment instructions: Topic 2: Use of GMO mosquitoes to eradicate zika virus carrying mosquitoes Now you need to research the topic and write a 500-1000 word (1 to 2 pages) writeup about the topic. Please us ...

How does dna polymerase facilitate the pcr

How does DNA polymerase facilitate the PCR reaction?

What is produced by fragmentation of the hyphae into their

What is produced by fragmentation of the hyphae into their component cells?

The protein produced by huntingtons disease huntingtin

The protein produced by Huntington's disease (huntingtin) interferes with general transcription factor (called CBP) and prevents it from binding the promoter. CBP activates genes involved in cell survival. i) Which step ...

What would happen to a patient with huntingtons if you

What would happen to a patient with Huntington's if you somehow manage to block the promoter region of the huntingtin gene?

Consider the food web for lake erie shown abovegive a

Consider the food web for Lake Erie shown above. Give a detailed analysis of this food web. Be sure to address the following in your analysis:  A description of the producers and consumers (you do not need to list every ...

What effect did grounding of the planes after 911 have on

What effect did grounding of the planes after 9/11 have on daily temperature ranges? Why was temperature affected?

Antropoligy online descution one paragraph and two

Antropoligy online descution One paragraph and two reply Patterns of Adaptation" How do humans adapt to environmental challenges? In this lesson, experts explore this question from many angles. The difference between acc ...

How many neutrons does element x have if its atomic number

How many neutrons does element x have if it's atomic number is 42 and it's mass number is 154?

Need a paper 0 of plagiarismreferences included 6-7 pages

Need a paper, 0% of plagiarism.references included. 6-7 pages single-spaced Topic is a brand "Chanel" 1. Evaluate the product, pricing, and channel strategies (Chapter 5). 2. Explain how the brand personalizes its market ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen