1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)
2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C
3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.
4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?
5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?
6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?
7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase