Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

Digestion is an important process in the human bodya

Digestion is an important process in the human body. a) Identify and describe the digestive processes. b) Consider the mouth, stomach, small intestines and large intestines - identify the digestive enzymes that are prese ...

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

As we get older we are prone to many conditions that affect

As we get older we are prone to many conditions that affect our bones, muscles and nerves. In your opinion how can these conditions be prevented?

Genetics- epigeneticsread the below article if you think

Genetics- Epigenetics Read the below article. If you think that you've perceived any flaws, overstatements/unsupported conclusions, or if you were simply left wondering about experiments that could have been done but wer ...

Ocean systemsaccording to the law of conservation of energy

Ocean Systems According to the law of conservation of energy, energy cannot be created or destroyed, but it can change from one form to another 1. A boy doing a cannonball into the pool. He went from potential to kinetic ...

First present the characteristics of water that make it

First present the characteristics of water that make it capable of hydrogen bonding. Then discuss why water is a good solvent and so readily exhibits capillarity. Finally, examine the heat properties of water, specifical ...

Eplain how microevolution can lead to macroevolution

Explain how microevolution can lead to macroevolution. Provide a hypothetical example to illustrate your explanation.

Research and briefly describe a real world example about

Research and briefly describe a real world example about acid rain affects plants. Be sure to demonstrate how pH contributes to the outcome, and proposed solutions. Descriptions should be approximately 2-3 paragraphs. In ...

Assignment150 word minimum for question 1 only any

Assignment 150 word minimum for question #1 ONLY. Any materials used in answering the questions must be put in your own words and the reference(s) must be properly cited. 1. According to some scientists, in developing co ...

Parents were concerned about their 16-year-old son for the

Parents were concerned about their 16-year-old son for the following reasons: he had no deepening of his voice, scanty pubic and axillary hair growth, absence of beard and mustache growth, small penis, poor muscular deve ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro