Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

If instead of making an energy drink you come up with an

If instead of making an energy drink, you come up with an energy injection, how would that affect the ingredients you put into the shot? Think in terms of polarity and tonicity.

Antropology book reviewanthropology 105book response value

Antropology Book Review Anthropology 105 Book Response (Value 20 points) Length: 750-1000 words, not including quotes or references Times New Roman Double spaced Late penalty: 1 point per day Review your worksheet respon ...

1 e coli is a shortened name for a bacterium that lives in

1. E coli is a shortened name for a bacterium that lives in our gut. According to the rules of binomial nomenclature it is properly written as _______________. a. Escherichia COLI b. Escherichia Coli c. Escherichia coli ...

Why is internalization important for respiration in animals

Why is internalization important for respiration in animals? and what does it mean?

Explain how these electrical currents of epsps and ipsps

Explain how these electrical currents of EPSPs and IPSPs are used in spatial and temporal summation to initiate or inhibit the generation of an action potential.

You are studying which of the multiple steps in gene

You are studying which of the multiple steps in gene expression you could tweak in order to produce a normal version of the huntingtin protein despite having the allele with the mutation. Which step in gene expression wo ...

Give the other component that makes up the cell membrane

Give the other component that makes up the cell membrane apart from the protein layer?

Discuss the applications of each of following in biology

Discuss the applications of each of following in biology today and include three examples of each with a brief description. a. DNA in forensic science b. Population evolution and microbial life c. Biological diversity ev ...

Much genetic evidence indicates that humans and chimpanzees

Much genetic evidence indicates that humans and chimpanzees are very closely related, despite the observation that chimpanzees have 48 chromosomes and we have only 46. At first, the difference in chromosome number was co ...

Urgent two immune system questionsactivated t-helper cells

URGENT: Two immune system questions: Activated T-helper cells aid in humoral immune responses by releasing cytokines which promote antibody production, phagocytosis, neutralization and apoptosis. Which parts of this stat ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro