Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

Biology1 a plant with red flowers is crossed with a

Biology 1. A plant with red flowers is crossed with a white-flowered plant of the same species. All the seeds, when grown, produce plants with red flowers. Assuming that the flower color is controlled by a single pair of ...

Discussion 1 and 2discussion 1- explain the difference

Discussion 1 and 2 Discussion 1- Explain the difference between the first and second line of body defenses against infection by pathogens Discussion 2- Identify the function(s) of the lymphatic system. Identify one diffe ...

Organic chemistry1 there is an attachement with 24

Organic Chemistry 1. There is an attachement with 24 molecules. Make three classification based on the function group. 2. Fill out the chart in the attactment. Complete the flowchart for the separation and isolation of: ...

Internet postings about whole foods and wild oatsfrom its

Internet Postings about Whole Foods and Wild Oats From its beginnings as one small store in Austin, Texas, Whole Foods Market has grown into the world's leading retailer of natural and organic foods, with hundreds of loc ...

Assignmentsimmunology1st assignmentsection ithe following

Assignments Immunology 1st Assignment Section I. The following Topics 1-3 (of 4) cover the cell isolation protocols from Units 1 & 2: Assigned Appendix readings; Isolation of human monocytes by double gradient centrifuga ...

In this assignment you will be writing a 1000-1250-word

In this assignment, you will be writing a 1,000-1,250-word essay describing the differing approaches of nursing leaders and managers to issues in practice. To complete this assignment, do the following: nursing shortage ...

Biology assignmentdiscuss any factor that enhances physical

Biology Assignment Discuss any factor that enhances physical development in chidren under age 8 a page. no need for formatting.

1 250 wordsargue in favor of regulating environmental

#1 250 words Argue in favor of regulating environmental estrogens presenting evidence specifically related to these chemicals and sexual development in the animal kingdom. Can sex determination be the result of errors an ...

Write a paper of 500-750 words not including the title page

Write a paper of 500-750 words (not including the title page and reference page) paper on Evidence-Based Solution on adoptions of Electronic Medical Record (EMR). Address the following criteria: 1. Proposed Solution: (a) ...

Based on your experience if you had to design a cell with a

Based on your experience, if you had to design a cell with a volume of 125 cm3, explain the best dimensions of the cell for the most efficient rate of diffusion? Hint: it may not be a perfect cube.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate