Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

1 much pharmaceutical research targets developing

1. Much pharmaceutical research targets developing anti-cancer drugs that can effectively stimulate the methylation of DNA. Formulate a possible hypothesis to explain why DNA methylation might be an effective anticancer ...

One major trend in the world today is green technology

One major trend in the world today is "green technology". Green technology is basically a term to encompass environmentally friendly technologies and inventions. Topic:  In this discussion board provide us with a link to ...

Using globe study results and other supporting data

Using GLOBE study results and other supporting data, determine what Japanese managers believe about their subordinates. How are these beliefs similar to those of the U.S. and European Managers? How are these beliefs diff ...

Compare and contrast spermatogenesis and oogenesis in

Compare and contrast spermatogenesis and oogenesis in humans.

A cell undergoing meiosis produces a daughter cell during

A cell undergoing meiosis produces a daughter cell, during which one nondisjunction event occurs. If the number of chromosomes in a normal diploid cell of this organism (not undergoing cell division) is 38, how many chro ...

Explain why nbspin psoriasis is an nbspthe cells in the

Explain why  in Psoriasis is an  the cells in the dermis and epidermis thickened. Decreased cell maturation occurs in psoriasis  as a result of? Reference/s  must be provided to make  sure the  information  you are tutor ...

The plasma membranes of polarized epithelial cells such as

The plasma membranes of polarized epithelial cells, such as those found in thetubules of the nephrons in the kidney, are divided into apical and basolateraldomains. How are these two domains different and how do the diff ...

How does sexual reproduction benefit the offspring in

How does sexual reproduction benefit the offspring in terms of genetic variation? Provide an example

Explain how resource partitioning led to character

Explain how resource partitioning led to character displacement in the interactions between the benthic and limnetic sticklebacks in Paxton Lake.

Knowing that acid rain has a ph of 2 - 3 would you conclude

Knowing that acid rain has a pH of 2 - 3 would you conclude that crop species with a narrow soil pH range are in trouble? Explain why, or why not, using scientific reasoning. Is acid rain a problem for plant species and ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen