Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

1which group of algae appears to be the most closely

1. Which group of algae appears to be the most closely related to the ancestors of true plants? Name one feature that appears to be homologous. 2. What are microphylls and which group of seedless vascular plants are they ...

1 give one hypothesis about the relationship between

1) Give one hypothesis about the relationship between protein sequence and protein color that you tested in the Aipotu I: Genetics & Biochemistry lab. 2) Give the genotype of each of the four starting strains of Aipotian ...

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

There is a common misconception that traditional taxonomy

There is a common misconception that traditional taxonomy is based on morphology, while cladistics is based on genetic data. How is this misconception incorrect?

Wellnessevaluate your own neighborhood and surrounding city

Wellness Evaluate your own neighborhood and surrounding city with regard to environmental factors related to wellness and connect your findings to the eight dimensions of wellesnn. Discuss as many environmental factors a ...

A man and a woman both have polydactyly ie six fingers on

A man and a woman both have polydactyly (i.e., six fingers on each hand), a trait which is determined in this example by a single gene. They have four children, none of whom have polydactyly. What is the probability thei ...

What is the definition for sporadic in What is the definition for sporadic in

What is the definition for sporadic in epidemiology?

We all see animals in our day to day lives choose a

We all see animals in our day to day lives. Choose a behavior you saw exhibited by an animal. Explain your thoughts on the potential proximate and ultimate causes of the behavior.

Discuss the mechanisms and consequences of adh and

Discuss the mechanisms and consequences of ADH and aldosterone on the kidneys

Name six specimen types that are often tested in forensic

Name six specimen types that are often tested in forensic toxicology; e.g. blood. Under what circumstances is each specimen preferred? Methadone is used to help drug addicts break the cycle. How does methadone work and i ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen