Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1. You are in a lab that is studying the process of DNA replication. You are particularly interested to know what exactly happens at the replication fork. To answer this problem, you have set up a series of DNA replication reactions in test tubes using physiological buffers and conditions. However, the student that you have hired to help you has accidentally set up every reaction incorrectly. For each scenario below, indicate if DNA replication will be affected by the mistake and describe why or why not.
A. No DNA Polymerase was added
b) rNTPs were added instead of dNTPs
c) No primase was added
d) Only dNTPs were added (no rNTPs)

2. The nucleic acid from various viruses was extracted and the base compositions determined. What type of nucleic acid (RNA or DNA) and single-stranded or double-stranded occurs in each virus?
Virus 1) 35% A, 35% T, 15% G, 15%C
Virus 2) 35% A, 15% T, 25% G, 25% C
Virus 3) 35% A, 30% U, 30% G, 5% C
Virus 4) 20% A, 20% U, 30% G, 30% C

3. Rank the following four double stranded DNA molecules in terms of their Tm's:
GTGCAC GTGCGCAC GTACTA GTAGTA
CACGTG CACGCGTG CAGCAT CATCAT
3. For the Cot curve shown below label the highly repetitive DNA, moderately repetitive DNA, and the unique DNA fractions.

4. A duplex of DNA is found to have [T] = 29%.
A. What can be said about the relative proportions of remaining bases in the duplex?
B. What is the melting temperature (Tm) of the DNA?

5. The DNA from the bacteriophage øX174 is single-stranded. Would you expect the DNA base composition to follow Chargaff's rules? Why?

6. A single-stranded DNA molecules has the following sequence:
5' GCATCATCATTTAAACCCGGG 3'
A. What chemical groups protrude from each end of this DNA chain?
B. Give the complementary DNA base sequence to include its polarity. Draw an arrow in the direction that replication would occur for polymerization of the complementary strand.
C. What is the %GC of this molecule?

7. What is the function of each of the following in DNA replication?
A. 3'-5'-exonuclease activity of a DNA polymerase
B. 5'-3'-exonuclease activity of DNA polymerase I in E. coli.
C. Helicase
D. Single stranded binding proteins (SSBPs)
E. Primase
F. Ligase

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925054

Have any Question? 


Related Questions in Biology

Discussion topicolder people die for a number of reasons

Discussion Topic Older people die for a number of reasons: cancer, heart failure, complications due to diabetes, stroke, Alzheimer's, etc. Often times, the way we live our lives affect not only how long we live but what ...

Explain why nbspin psoriasis is an nbspthe cells in the

Explain why  in Psoriasis is an  the cells in the dermis and epidermis thickened. Decreased cell maturation occurs in psoriasis  as a result of? Reference/s  must be provided to make  sure the  information  you are tutor ...

Climate of Climate of Doubt:  www.pbs.org/wgbh/frontline/film/climate-of-doubt/ this

Climate of Doubt:  www.pbs.org/wgbh/frontline/film/climate-of-doubt/ this video is about 1 hour watch.  Anyone who answer this question skill this video up to 25min then watch the rest. 1. Who is Bob Inglis and what happ ...

Questionat least two of the primary factors thought to be

Question: At least two of the primary factors thought to be involved in the observed changes in atmospheric CO 2 levels since the Industrial Revolution Part: How the Carbon Cycle Relates to Global

1 what are the benefits of sequencing the genome of an

1) What are the benefits of sequencing the genome of an organism? Explain by giving 3 examplesfor the applications of genomic information. 2) Why do not modern apes become human today? World limit is between 250-400

Write a 5 page paper on anything to do with biology thats

Write a 5 page paper on anything to do with Biology. That's right... ANYTHING! Find something you are interested in and investigate it! It can be a person, a topic, a new technology... do something that interests YOU! Re ...

Two adjacent filaments of spirogyra affins each 10 cells

Two adjacent filaments of spirogyra affins each 10 cells participating in reproduction. How many new Spirogyra plants are produced during sexual reproduction?

Identifynbspan organism that lives within 50 miles of your

Identify  an organism that lives within 50 miles of your home.  I live in Panama City, Florida 32405 I would like to use the wolf please? Write  a 1,050- to 1,400-word paper about how the organism has adapted to survive ...

You are studying which of the multiple steps in gene

You are studying which of the multiple steps in gene expression you could tweak in order to produce a normal version of the huntingtin protein despite having the allele with the mutation. Which step in gene expression wo ...

A foreign america executive finds that a foreign subsidiary

A foreign America executive finds that a foreign subsidiary in a poor nation has hired a 12-year-old girl to work on a factory floor, In violation of the company's prohibition on child labor. He tells the local manager t ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen