(Answered) Sequence 1 and sequence 2 are short sequences of dna with a

Academics

Sequence 1 and sequence 2 are short sequences of DNA with a message. To decipher the message, you will need to first transcribe and then translate the sequences. Using the single letter code of each amino acid obtained upon translating the sequence, crack the message contained. Please note that there are only 20 amino acids. Therefore, you may need to insert any/all of the letters B, J, O, U, X, Z to complete the message.

DNA Sequence 1: 3'- CGGGGGCGGTAG

TCCTCAACCTAGTGGGTGTGG - 5'

DNA Sequence 2: 3'- AGGACGTA

GCTTTTAACGCTCTAAAGGAAATTA- 5'

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M92854162
Price:- $10

Verified Expert

Priced at $20 Now at $10, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Biology

Question dietary recommendation and analysis projectin this

Question: Dietary recommendation and analysis project In this project, you will use software to analyze our own diet and make dietary recommendation. You will need submit a report. You can choose any of software if you f ...

Quesiton synthetic chromosomes transcriptomes and patents

Quesiton: "Synthetic chromosomes, Transcriptomes, and Patents on BRCA genes" For your primary post, please respond to one of the following three topics with a post of at least 125 words that addresses each point given in ...

Two true-breeding stocks of pea plants are crossed one

Two true-breeding stocks of pea plants are crossed. One parents has red, axial flowers and the other has white terminal flowers; all F1 individuals have red, axial flowers. The genes for flower color and location assort ...

Question darwin was not the first to consider evolution as

Question: Darwin was not the first to consider evolution as a process but he did come up with the first effective explanation for how it happens. Describe Darwin's theory of evolution by natural selection. Explain how th ...

Case study question -case study - mary 21 years old

Case Study Question - Case Study - Mary, 21 years old, presented to the hospital emergency department with an infected laceration on her left foot. Mary was at a beach resort four days ago, when she trod on a broken glas ...

Question overview although it may sound like science 2520

Question: Overview: Although it may sound like science 2520, DNA and RNA technologies are already used in products today. In this discussion you will examine one specific product, organism, or technology in your initial ...

What problems does this traditional classification scheme

What problems does this traditional classification scheme of protists create in our understanding of the evolutionary relationships that exist between protists?

Experiment 1 symmetry in common objectsreview the objects

Experiment 1: Symmetry in Common Objects Review the objects listed below (many of which can be found in your lab kit). Decide what type of symmetry they possess. Explain why you chose the type of symmetry you did. 1. Saf ...

1 identify the maternal homolog for both chromosome 1 and 2

1.) Identify the maternal "homolog" for both Chromosome 1 and 2 and then the paternal homologs. Arrange these chromosomes as you would expect to find them during G 1 of interphase. What is the haploid number of our ce ...

A cross between a person with straight hair and a person

A cross between a person with straight hair and a person with curly hair will produce a child with wavy hair. If 2 people with wavy hair had a child, what are the odds that the child would have straight hair?

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert