Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Biology Expert

Questions: Provide specific answers in your own words. Be as detailed and specific as possible.

1. Provide several reasons why you might choose to express a protein in a prokaryotic system.

2. Provide several reasons why you might choose to express a protein in a eukaryotic system.

3. The PCR that your labmate designed is resulting in virtually no amplification. Her amplification conditions look OK, so you suspect there might be a problem with the design of her primers. What seems to be the source of the issue with her PCR? If possible, also include a diagram illustrating your answer. (Hand-drawn is OK if you are unable to generate a computerized

imageForward Primer:                             Reverse Primer:
5'- TGGACCTGGCAATACTCAGG -3'   5'- ACTCCTAGCAACGGTGAACT -3'

4. Your labmate had his headphones in and was jamming out to 1989, Taylor Swift's latest album, so he wasn't really paying attention when he set up his electrophoresis gel. You walked into the room just as he turned on the power button. What's wrong with the setup he used? What will happen if the gel is allowed to run? Why? (Hint: You only have about 2 minutes to correct his mistake before it's too late and he'll have to start all over again!)

1606_Electrophoresis gel.png

Adapted from: Campbell, M., & Farrell, S. (2012). Biochemistry (7th ed.). Belmont, CA: Brooks/Cole, Cengage Learning.

5. You have received a sample of a new pathogen with a 10 kb genome. In order to obtain preliminary information on its genome organization, you perform restriction enzyme digestion using HindIII and Sau3AI individually as well as in combination. Provide an explanation describing and/or diagram showing the location of the HindIII and Sau3AI cut sites within the genome. (Note that one band in the double digest is twice as bright as all the other bands

2096_Electrophoresis gel1.png

6. The use of synthetic biology to develop molecular logic gates has allowed the design of complex synthetic genetic pathways with myriad combinations and applications possible. Now organisms can be engineered to perform genetic "calculations" and respond in specific ways under specific predetermined conditions.

a) The results from logic gates can be represented in what is known as a "truth table". The two input conditions are listed (0 = off; 1 = on), along with the output condition. For a molecular AND gate, fill in the output condition in the truth table below.

380_Gate.png

 

A

B

Output

0

0

?

0

1

?

1

0

?

1

1

?

b) Just like a molecular AND gate produces its output when both input A and B are present, a molecular OR gate produces its output when either input A or B are present:

2141_Gate1.png

A

B

Output

0

0

0

0

1

1

1

0

1

1

1

1

With that knowledge, examine the composite logic gate below, which is made up of an AND gate and an OR gate, the outputs of which each feed into another AND gate.

82_Gate2.png

If the inputs for the initial gates are controlled by the inducing chemicals A, B, C, and D (absence of the chemical = 0; presence of the chemical = 1), construct a truth table for the composite logic gate. (Hint: there are 16 possible input combinations.)

Biology, Academics

  • Category:- Biology
  • Reference No.:- M91669095
  • Price:- $60

Guranteed 36 Hours Delivery, In Price:- $60

Have any Question?


Related Questions in Biology

The united states established the first national park in

The United States established the first National Park in the world on March 1, 1872. What does this say about the people of the United States?

Calculate the concentrations at eqbm of h2co3 hco3- co32-

Calculate the concentrations at eqbm of H2CO3, HCO3-, CO32-, and H+ in a saturated aq solution of H2CO3 in which the original concentration of H2CO3 is 0.034M (Ka1= 4.3*10^-7, Ka2 = 4.8*10^-11)

What is the complementary strand for 5-atgcatgcatgccc-3how

What is the complementary strand for: 5'-ATGCATGCATGCCC-3' How many turn(s) will this strand have? Are Eukaryotic cells always diploid during S phase whereas bacteria are only haploid at the end of DNA replication?

John is a 53-year old contraction worker who has come into

John is a 53-year old contractIon worker who has come into your office complaining of a sore knee joint. You see a buildup fluid close to the patella (kneecap) but deep to the skin and suspect the soreness is due to burs ...

Diffusion and osmosis questionin your large intestine the

Diffusion and osmosis question In your large intestine, the water from the food you have eaten needs to be kept in the body to prevent dehydration. Therefore the high concentration of water in feces needs to be moved int ...

In some varieties of chickens as in snapdragons incomplete

In some varieties of chickens, as in snapdragons, incomplete dominance involves three colors: white (aa) blue (Aa), and black (AA). If a blue male chicken is mated with a blue female, what are the expected phenotypic and ...

You have been allocated a cdna accession number from the

You have been allocated a cDNA accession number from the NCB' database (see table below on page 2). Your task is to design experimental strategies that will allow you to: clone the cDNA in different expression vectors us ...

Choose one of the areas mentioned above that you would like

Choose ONE of the areas mentioned above that you would like to learn more about and write two or three paragraphs describing the process and how it relates to metabolism within the cell. Provide at least one specific (na ...

Question phytoplankton chemosynthesis and mitochondriafor

Question: "Phytoplankton, Chemosynthesis, and Mitochondria" For your primary post, please respond to one of the following three topics with a post of at least 125 words that addresses each point given in the instructions ...

Which are the logical steps proposed by margulis that would

Which are the logical steps proposed by Margulis that would help explain why the accumulation of oxygen in the atmosphere led to the evolution of mitochondria.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As