Problemin the human gene for the beta chain of hemoglobin, Ask an Expert

Academics

Problem:

In the human gene for the beta chain of hemoglobin, the oxygen-carrying protein in the red blood cells, the first 30 nucleotides in the protein-coding region are shown here: 3' TACCACGTGGACTGAGGACTCCTCTTCAGA 5'

Required:

Question 1: What is the sequence of the partner strand?

Question 2: If the DNA duplex of this gene were transcribed from left to right, what is the base sequence of the RNA across this part of the coding region?

Question 3: What is the sequence of amino acids in this part of the beta-globin polypeptide chain?

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M91149483

Have any Question?Write your Review or question?

Related Questions in Biology

Choose one of the areas mentioned above that you would like

Choose ONE of the areas mentioned above that you would like to learn more about and write two or three paragraphs describing the process and how it relates to metabolism within the cell. Provide at least one specific (na ...

What changes would you expect to see in the liver cells of

What changes would you expect to see in the liver cells of someone suffering from chronic alcoholism?

Describe the form of endocytosis that involves the movement

Describe the form of endocytosis that involves the movement of large amount of liquid into the cell.

Question darwin was not the first to consider evolution as

Question: Darwin was not the first to consider evolution as a process but he did come up with the first effective explanation for how it happens. Describe Darwin's theory of evolution by natural selection. Explain how th ...

A patient had abnormally low ch50 results ie abnormally low

A patient had abnormally low CH50 results (i.e., abnormally low lysis of antibody coated sheep red blood cells) would abnormally low levels of Bb explain the CH50 assay results? Why or Why not?

The ch50 assay is a traditional clinical assay that

The CH50 assay is a traditional clinical assay that measures the function of complement components. In a CH50 assay patient blood is drawn and serum separated from it (serum has no cells). Patient serum is mixed with ant ...

Calculate the concentrations at eqbm of h2co3 hco3- co32-

Calculate the concentrations at eqbm of H2CO3, HCO3-, CO32-, and H+ in a saturated aq solution of H2CO3 in which the original concentration of H2CO3 is 0.034M (Ka1= 4.3*10^-7, Ka2 = 4.8*10^-11)

Question identify an organism that lives within 50 miles of

Question: Identify an organism that lives within 50 miles of your home. Write a 1,050- to 1,400-word paper about how the organism has adapted to survive in their specific environment. Include the following points in your ...

If the atomic number of an element is 12 and the atomic

If the atomic number of an element is 12 and the atomic mass is 25. How many protons are there in the nucleus? How many neutrons are there in the nucleus? How many electrons are in the atom?

Question write a 525- to 700-word paper on the genetic

Question: Write a 525- to 700-word paper on the genetic disorder (Sickle Cell Disease ). Include the following in your paper: Summarize the Chromosomal Theory of Inheritance and how chromosomal abnormalities can lead to ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert