Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Discuss the mechanisms by which the lactoselac operon

Discuss the mechanisms by which the lactose(lac) operon functions in medium with an excess of lactose and a medium with lactose excess and glucose. Give 10 points

How does sexual reproduction benefit the offspring in

How does sexual reproduction benefit the offspring in terms of genetic variation? Provide an example

You are caring for a patient who is extremely ill but might

You are caring for a patient who is extremely ill, but might be helped if he could get access to a drug that is already approved in Europe. Write a paragraph describing why it is sometimes a good thing for drugs not to b ...

Cell cycle checkpoints are an important feature of a

Cell cycle checkpoints are an important feature of a dividing cell to reduce errors that can occur in various stages of the cell cycle. Loss of Rb, an important part of the G1-S transition checkpoint, can result in uncon ...

Recent scientific and public policy discussions have

Recent scientific and public policy discussions have focused on some natural and man-made substances, external to the body, and whether or not these substances interact with the endocrine system. The topic of "endocrine ...

Wellnesssynthesize in about 250 words an overview of what

Wellness Synthesize, in about 250 words, an overview of what you have learned from the course with regard to health and wellness. How do the various aspects of wellness influence one another? How do different disciplines ...

In which parts of a plant where photosynthesis takes

In which parts of a plant where photosynthesis takes place?

What did the experiments by stanley miller demonstrate

What did the experiments by Stanley Miller demonstrate about the formation of the first organic molecules? Why was it significant?

Biodiesel fuel is produced from oils synthesized by and

Biodiesel fuel is produced from oils synthesized by and harvested from living plants. How does the use of biodiesel fuel compare to the use of fossil fuels with respect to the amount of carbon dioxide released into the a ...

1 how cando you reduce the amount of waste and pollution

1. How can/do YOU reduce the amount of waste and pollution that you create?  In other words, describe 3 things that you can do/already do to reduce, reuse and recycle more. 2. The City of Phoenix recently started a progr ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro