Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Cyclin-dependent kinases are special molecules that

Cyclin-dependent kinases are special molecules that facilitate the progression of a cell through the cell cycle. Many molecules such as p53 regulate the cell cycle. An unregulated cell cycle can lead to rapid growth of t ...

Out of proteins lipids and carbohydrates present in a cell

Out of proteins, lipids and carbohydrates present in a cell membrane, which of the three is minimum?

Case study 20 food for a low-income familysarah is a

Case Study 20: Food for a Low-Income Family Sarah is a 30-year-old mother of two young children, ages 3 and 5. Her husband was recently disabled in a car accident and has been unable to work for 6 months. Sarah works par ...

What are two ecosystems in the region where you live

What are two ecosystems in the region where you live (Southeastern US) where you live? What are some examples of intrinsic and instrumental values provided by the ecosystems?

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

Where have you observed an ecosystem change over time how

Where have you observed an ecosystem change over time? How would you describe the biodiversity - in terms of species richness and evenness - of the place and how the change affected biodiversity? What are the positive an ...

1 describe the four main pressure areas of the northern

1. Describe the four main pressure areas of the Northern Hemisphere and discuss their effects on major wind patterns. 2. Describe and explain the formation and effects of the monsoon winds of southern Asia

Question 1some parts of the brain that belong to the limbic

Question 1 Some parts of the brain that belong to the limbic system are the a) amygdala and hippocampus b) basal ganglia and cingulate cortex. c) thalamus and hypothalamus. d) pons, cerebellum, and medulla oblongata. Que ...

Choose a species of plant or animal and research its basic

Choose a species of plant or animal and research its basic biology. Describe your species and its ecology. What kinds of factors are likely to regulate the population size of this species? Can you name any specific facto ...

Microbiology1 for what specific purpose was gram staining

Microbiology 1. For what specific purpose was gram staining developed for? what is it used for today? 2. Why is the presence of air bubbles a sign of contamination? 3. Why is a gram stain helpful when monitoring bacteria ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen