Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Steroid hormones such as testosterone are derived from

Steroid hormones, such as testosterone, are derived from cholesterol. What type of macromolecule are they?

Ocean systemsaccording to the law of conservation of energy

Ocean Systems According to the law of conservation of energy, energy cannot be created or destroyed, but it can change from one form to another 1. A boy doing a cannonball into the pool. He went from potential to kinetic ...

Evidence into diabetic care practicebased on the summary of

Evidence into Diabetic Care Practice Based on the summary of research findings identified from the Evidence-Based Project-Paper on Diabetes that describes a new diagnostic tool or intervention for the treatment of diabet ...

Some boxers and wrestlers dehydrate abruptly by spending

Some boxers and wrestlers dehydrate abruptly by spending time in a sauna and sweating a lot in order to lose weight and compete with a lower tier, however this is a serious health hazard, explain what happens to the toni ...

Two questions to be answered1 government and the arts

TWO Questions to be answered 1. "Government and the Arts; Abstract Expressionism and Music" Please respond to one of the following, using sources under the Explore heading as the basis of your response: • Examine the U.S ...

Identify and give functions of the organs and structures of

Identify and give functions of the organs and structures of the urinary system.

There are approximately 4000 dna sites in the yeast genome

There are approximately 4000 DNA sites in the yeast genome which could potentially bind the yeast transcription factor GAL4, but only 10 sites control genes necessary for galactose metabolism. In one chromatin immunoprec ...

Explain why nbspin psoriasis is an nbspthe cells in the

Explain why  in Psoriasis is an  the cells in the dermis and epidermis thickened. Decreased cell maturation occurs in psoriasis  as a result of? Reference/s  must be provided to make  sure the  information  you are tutor ...

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen