Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Steroids hormonessuch as testosterone are derived from

Steroids hormones,such as testosterone, are derived from cholesterol. What type of macromolecule are they?

Schedule slippage and delays are common for project

Schedule slippage and delays are common for project managers to manage. Experience contributes to a project manager's ability to address schedule impacts. Discuss how organizations can utilize the Learning Theory and Pro ...

Topic genomicsquestion describe how the use of genetic

Topic: Genomics Question: Describe how the use of genetic knowledge can change the course of disease. What are the implications of the prolific use of genetic knowledge for the intervention of disease? Should there be an ...

How does complementary base pairing facilitate dna

How does complementary base pairing facilitate DNA replication and the processes of transcription and translation? Identify the base pairs in each process.

Describe the purpose of the human genome project and how it

Describe the purpose of the Human Genome project and how it was achieved. Form a hypothesis of future research that could benefit from the HGP.

Explain why type abblood may be called the universal

Explain why type AB+blood may be called the "universal recipient" for blood transfusion. Explain why this would not be true if the transfusion required 6 units( about 3 liters) of blood.

Social unrest in west africa where sickle cell anemia is

Social unrest in West Africa, where Sickle cell anemia is most common, is forcing people to migrate to other countries. As a result, sickle cell anemia cases are rising in Europe and the US in recent years. Is the US pop ...

Focusing on thenbsprespiratory digestive urinary and

Focusing on the  respiratory, digestive, urinary, and reproductive systems.   Create a scenario  and give your patient a disease associated with any of these systems and present the history and symptoms of the particular ...

Focus on case studies in neurologyfor this assignment you

Focus on Case Studies in Neurology For this assignment you will respond to three case studies. What is a Case Study? "A case study is a narrative used to help you practice real-life analysis and communication skills. It ...

Discussion boardthis is only a discussion board not an

Discussion Board This is only a discussion board, not an essay! please follow all the instructions and answer the questions within the bullet that you chose. "Evolution of Animals and Population of Humans" Note: Online s ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro