Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Why is a sucrose-phosphate buffer used in preparation of

Why is a sucrose-phosphate buffer used in preparation of liver homogenate?

Describe the different stages of development as a fetus

Describe the different stages of development as a fetus matures.

The end products of both mitosis and meiosis is a set of

The end products of both mitosis and meiosis is a set of chromosomes. Explain the differences between the two sets. Suppose that Mendel had decided to use dogs for his experiments. What problems would he have had that he ...

Prevention of disease through vaccinationchoose a

Prevention of Disease through Vaccination Choose a diseases/disorder that you learned about this week that can be prevented through vaccination.  Research the disease background including etiology, symptoms, treatment, a ...

Describe how the central nervous system is protected from

Describe how the central nervous system is protected from injury. List the components of a spinal reflex arc. Describe the function of each component.

Is it appropriate to say that all changes in the nucleotide

Is it appropriate to say that all changes in the nucleotide sequence of protein-encoding DNA result in new alleles? Explain. (This is sort of a judgment call. It depends on how broadly or narrowly you define the term all ...

Fluid electrolyte and acidbase balancedescribe the

Fluid, Electrolyte and Acid/Base Balance Describe the physiological roles of sodium, potassium, calcium, chloride, and phosphates. State the term for an excess or deficiency of each electrolyte and describe the consequen ...

Identify the alga known for biological activity called

Identify the alga known for biological activity called bioluminescence?

Color blindness is an x-linked recessive trait a

Color blindness is an X-linked recessive trait. A color-blind man has a daughter with normal color vision. The daughter marries a man who has normal color vision. What is the expected phenotypic ratio of their children? ...

Elisa uses an enzyme-linked antibody to detect and antigen

ELISA uses an enzyme-linked antibody to detect and antigen. Briefly explain how use of the enzyme is ELISA could amplify the detection of a very small amount of antigen in a sample.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen