Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

What is normally presented on the mhc i complex of antigen

What is normally presented on the MHC I complex of Antigen presenting cells? When does it present foreign peptide on its MHC I complex? Can they present self peptides on their MHC I complex, but foreign peptides on their ...

In this assignment you will select a fermented food or

In this assignment, you will select a fermented food or beverage from the list provided. After making your selection, you will prepare a 3 page written report about it. The report should include historical information re ...

How to define which domain of membrane protein is

How to define which domain of membrane protein is intracellular or extracellular domain?

In an experimental template having perfectly placed 5

In an experimental template having perfectly placed 5 nucleosomes there is a single EcoR1 site buried near dyad axis of the 3rd nucleosome. Is it possible for a modeller to make this site accessible without disturbing an ...

Trace the pathway of the blood through the heart and

Trace the pathway of the blood through the heart and differentiate between pulmonary, systemic, and cardiac circulation.

Trace the pathway of the blood through the heart and

Trace the pathway of the blood through the heart and differentiate between pulmonary, systemic, and cardiac circulation.

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

Out of proteins lipids and carbohydrates present in a cell

Out of proteins, lipids and carbohydrates present in a cell membrane, which of the three is minimum?

The entire protoplast of the cell recedes from the cell

The entire protoplast of the cell recedes from the cell wall and is surrounded by a thick wall to for what?

What are the characteristics of tropical waters temperate

What are the characteristics of tropical waters, temperate waters and polar waters?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro