Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

List the following in order from smallest to largest

List the following in order from smallest to largest: (Chromosome, DNA, Chromatin, Chromatid, Gene, Nucleotide)

Your friend bruce calls in a panic he has just come from

Your friend Bruce calls in a panic. He has just come from the doctor and been diagnosed with a bacterial infection. The doctor told him not to worry; his B cells will take care of it in no time! Knowing that you are stud ...

Problem 1 the schlogl modelthis model is famous for its

Problem 1: The Schlogl Model This model is famous for its bistable steady-state distribution. The reactions are              c1 B1 + 2X ? 3X,              c2      c3 B2 ? X,      c4 where B 1 and B 2 denote buffered spec ...

Why is thermoregulation so important based on the q10nbspof

Why is thermoregulation so important based on the Q 10  of a physiological process?

Once the hypothalamus has detected low levels of calcium in

Once the hypothalamus has detected low levels of calcium in the bloodstream, describe the full cascade of events that leads to low bone density. Also describe the cascade that allows the dairy product to contribute to ci ...

Differentiate between ectoderm mesoderm and endoderm and

Differentiate between ectoderm, mesoderm and endoderm and list what tissues arise from each.

Assignmentuse what we have learned about biomimicrycreate a

Assignment Use what we have learned about biomimicry Create a 1 page document- "Working Towards a Sustainable Society" Project: • Develop a thesis statement- then back that up with ways we can get there. • Describe the c ...

John has difficulty swallowing loss of taste sensation in

John has difficulty swallowing, loss of taste sensation in the posterior one-third of the right half of his tongue, and decreased salivation, especially on the right side. Describe the sensory portion of the affected neu ...

Which component of a muscle does the ca combine with to

Which component of a muscle does the Ca^++ combine with to allow a contraction to occur? When a muscle is simulated before the muscle can fully relax, it can cause muscle twitch tetarus muscle tendritis When a muscle is ...

Environmental science final projectcreate hour to hour and

Environmental Science Final Project Create hour to hour and half long POWER POINT lecture (20-25 slides) using the following topics: Human Population Dynamics, Recent Climate Change, Ozone in the Atmosphere and they Hyrd ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen