Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Do you think there are political issues surrounding human

Do you think there are political issues surrounding human population growth? Why or why not? Can you give an example?

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

Question 1some parts of the brain that belong to the limbic

Question 1 Some parts of the brain that belong to the limbic system are the a) amygdala and hippocampus b) basal ganglia and cingulate cortex. c) thalamus and hypothalamus. d) pons, cerebellum, and medulla oblongata. Que ...

What type of reproduction involves union of sex cells and

What type of reproduction involves union of sex cells and their nuclei?

The lac operator binds the lac repressor the dna sequence

The lac operator binds the lac repressor. The DNA sequence of the lac operator shares a characteristic with the DNA sequences of the binding sites of many restriction enzymes. What is this common characteristic?

Lion can you please describe some adaptations that that

Lion: can you please describe some adaptations that that species developed that allow them to survive in their native habitat?

Please follow the rubric with the name tina jones

Please follow the rubric with the name tina jones 28-year-old female admitted to shadow general hospital for a right infected foot after cutting it on a ladder falling off a stepstool, turned into cellulitis. Treated in ...

1 describe the three classes of carcinogens and their sub

1. Describe the three classes of carcinogens and their sub classes; describe the role each plays in the cancer process and give chemical examples. 2. Describe six points in the cancer process where the process can be inh ...

How does complementary base pairing facilitate dna

How does complementary base pairing facilitate DNA replication and the processes of transcription and translation? Identify the base pairs in each process.

Create a patient scenario but dont give away the

Create a patient scenario but don't give away the disease.  First explain the terms opportunistic and true pathogen. Also differentiate between syndrome, signs and symptoms of disease so everyone will have an idea of wha ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro