Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Look up in your textbook or internet source information on

Look up in your textbook or internet source information on how each of these drugs works on the cellular level and complete the chart below. Be sure to note your source of information. DRUG HOW IT WORKS AT CELLULAR LEVEL ...

Give four natural processes that result in dna transfer

Give four natural processes that result in DNA transfer between bacteria cells?

State which cells in a human testis produce testosterone

State which cells in a human testis produce testosterone and its function(s) and state which hormones are produced by a human ovary, and their functions.

Bacterial srnas activate and repress translation by

Bacterial sRNA's activate and repress translation by exposing or covering RBS (ribosome binding site) on mRNA. Riboswitches also activate and repress translation by exposing or covering RBS on mRNA. How do these two regu ...

Color blindness is an x-linked recessive trait a

Color blindness is an X-linked recessive trait. A color-blind man has a daughter with normal color vision. The daughter marries a man who has normal color vision. What is the expected phenotypic ratio of their children? ...

State an industrial concernimportance for knowing the

State an industrial concern/importance for knowing the genetic makeup of an organism. Explain why it is important in your example.

In high altitudes is it necessary to have more or less

In high altitudes is it necessary to have more or less hemoglobin? Why is carbon monoxide toxic for humans? How is heart contraction triggered?

How when where and why might you apply your learning of

How, when, where and why might you apply your learning of bioethics in the future if you wanted to be a veterinarian?

What did the experiments by stanley miller demonstrate

What did the experiments by Stanley Miller demonstrate about the formation of the first organic molecules? Why was it significant?

Where have you observed an ecosystem change over time how

Where have you observed an ecosystem change over time? How would you describe the biodiversity - in terms of species richness and evenness - of the place and how the change affected biodiversity? What are the positive an ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro