Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of the NASA land rovers returns from its mission with a variety of samples. from one, a unique bacterial species been isolated and cultured. your jab is to investigate whether or not the genetic code is overlapping or nonoverlappin. Another researcher has discovered that rather than a codon of three nucleotides, this organism used groups of four nucleotides. Show how you would verify the presence of overlapping versus nonoverlapping frames when you thought the codon was read in groups of three nucleotides and in groups of four nucleotides. How would you data have been different without the knowlege of codons as groups of four nucleotides.

test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M943867

Have any Question? 


Related Questions in Biology

Unit idiscuss why it is important that the public be

Unit I. Discuss why it is important that the public be knowledgeable about science and how it applies to the real world. Unit II Oil spills in the ocean are often treated with chemical dispersants. These materials are si ...

Researchers are working to develop biofuels to free us from

Researchers are working to develop biofuels to free us from dependence on fossil fuels. Based on what you know about cellulose, what do you predict are the major advantage and disadvantage of using cellulose-rich plant m ...

Questionkayla brings riley now 18 months in for complaint

Question: Kayla brings Riley, now 18 months in for complaint of fever and cough. The fever began 3 days ago and is of normal levels in the morning then gets as high as 100 to 101 degrees in the afternoons. Riley has also ...

Conclusion for five kingdom classification merits and

Conclusion for five kingdom classification merits and demerits.

Assignmentappendix c organizational requirements for

Assignment Appendix C: Organizational Requirements for Phototropism Virtual Laboratory Paper Introduction: Provide readers with the experiment's background information, and present the hypothesis in approximately 175 wor ...

Question 1 in drosophila melanogaster eyeless ey is a

Question 1: In Drosophila melanogaster, eyeless (ey) is a recessive trait in which the eyes are tiny or absent. The ey locus is found on chromosome 4. Monosomy and trisomy for this very small chromosome are compatible wi ...

Pick a type of cancer to research find articles that answer

Pick a type of cancer to research. Find articles that answer questions concerning your chosen type of cancer. An annotated bibliography consists of two parts: the reference citation in APA format, followed by the summary ...

Biological markers ndash nutritional status of an

Biological Markers – Nutritional Status of an individual Blood And The case of the mixed up case files Whats going on around here You have been handed a written report on an individual, but the labels on the biological s ...

Posted in description areaquestions 1response should be at

Posted in Description Area Questions 1 Response should be at least 200 words in length. All sources used, including the textbook, must be referenced; paraphrased and quoted material must have accompanying in-text citatio ...

You have been asked to investigate a new procedure that

You have been asked to investigate a new procedure that physicians would like nurses to adopt in the hospital. Discuss the process you would apply to determine whether the procedure falls within the RN scope of practice ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate