A. Indicate with an arrow the direction that DNA Polymerase would elongate the "primer" DNA strand on this double-stranded DNA molecule in the presence of dNTPs. What would be the sequence of new nucleotides synthesized (i.e., not the primer nucleotides) after addition of DNA polymerase and dNTPs? How many nucleotides would be incorporated if dATP, dCTP, dTTP and the dideoxy nucleotide ddGTP were used in this reaction instead of all four dNTPs?
5'PO2--GATCGAGCGCATTAAAATGCTCCTCGGGGACACA-OH3' Template strand
3'HO-ATTTTACG-PO2-5' Primer strand
B. A single strand of a double-stranded DNA sequence is shown below. Design two primers, each 10 base-pairs long that can base-pair with either the strand of DNA shown or its complement in the regions that are not underlined that will result in the PCR amplification of the underlined region that will be between the primers. (Note that real PCR primers would typically be 18 to 20 bases in length)
Sequence of top strand of dsDNA:
5'ACGAGATCAGATGTTTCTTACCGTCGGGGCCGCCTTTAAATAAAGCTGTGTCA3'
If you are having trouble, write out both strands of the DNA sequence, find the place where each primer can bind, and then diagram a cycle of PCR, paying careful attention to the rule that all DNA polymerases (including Taq DNA pol.) work by extending a 3' end. Study Figure 20.24, and note carefully the location of 3' and 5' ends of all strands.
C. Based on the article "Sleeping with the Enemy," what genes are being studied as candidates for genes that make modern humans different in phenotype from Neanderthals? When was the last common ancestor of humans and Neanderthals? (I think I gave the wrong date in class!). What does the evidence for limited exchange of genes between humans and Neanderthals, and humans and Denisovan hominids, say about the degree to which these were separate species?