1. In two closely related bacterial species, an operon with five structural genes is found on the chromosome, with the genes arranged in the same order. However, in species B, gene X, which is NOT present in species A, is found between genes 2 and 3 of the five gene sequence.
a. Draw a schematic representation of the two operons.
b. If gene X has no sequence homology to any other gene in species B, how might it have arisen?
c. If the nucleotide sequence of gene X is 72% identical t gene 2 in species B, how might it have arisen?
2. The -10 and -35 sequences in bacterial promoters are separated by about two turns of the DNA double helix (remember genetics?). How do you think transcription would be affected if a deletion were introduced such that the -35 sequence was moved to the -29 position?
3. In bacteria, genes within an operon are transcribed under the control of a single promoter and the primary mRNA transcript contains sequences that can be translated into each of the independent proteins. In some cases the first gene in the linear sequence appears to be transcribed at a much higher rate than the second and subsequent genes (i.e. many but not all mRNAs contain the sequences encoded by gene 2 and beyond). 
What kind of DNA sequences might be present between the first and second genes to account for this discrepancy on transcript numbers?
4. Self-splicing introns do not require an energy source, such as ATP or GTP, to catalyze splicing. How do you think that self-splicing proceeds with a reasonable yield of products (hint: think about what is happening at the phosphodiester bond level)?
5. What accounts for the directionality of mRNA transport out of the nucleus? Draw a schematic representation of this process.
6. There are numerous sequences within mRNAs that could encode start codons (AUG). How is the correct start codon recognized?

7. Translate the following sequence into all six reading frames. Which reading frame do you think most likely encodes a functional protein? Why?

5' GTCCATGGAACCATCTCTCAAGTATATCAACAAGAAATTTCCCA ACAT 3'
8. Name the types of chemical bonds that link:
a. Adjacent amino acids in the a protein
b. An amino acid to tRNA
c. Adjacent nucleotides in RNA
d. A codon in mRNA to an anticodon in tRNA
e. The two subunits of a ribosome

9. A mutation in an organism's DNA results in a lack of production of a function exon-junction complex. What effect to you think this would have on the ability of the cell to make mature mRNA transcripts? What do you think the overall outcome of this mutation with respect to cellular viability will be?

10. A mutation occurs that abolishes the ability of importin α to associate with exportin. Predict what consequences this will have on the transport of proteins that contain NLS sequences. Do you think this will have any effect on the ability of proteins less than 35 kDa in size to move in or out of the nucleus?