Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

1 how is gene expression regulated give three different

1. How is gene expression regulated (give three different forms of regulation mechanisms)? 2. How does gene regulation relate to cancer development?

Assignment biology concepts and investigations marielle

Assignment: BIOLOGY CONCEPTS AND INVESTIGATIONS. MARIELLE HOEFNAGELS. THIRD EDITION 1. (CHAPTER1) Imagine that you are a scientist working with one of the first research teams sent to the planet Mars. One day, while digg ...

The plasma membranes of polarized epithelial cells such as

The plasma membranes of polarized epithelial cells, such as those found in thetubules of the nephrons in the kidney, are divided into apical and basolateraldomains. How are these two domains different and how do the diff ...

One major trend in the world today is green technology

One major trend in the world today is "green technology". Green technology is basically a term to encompass environmentally friendly technologies and inventions. Topic:  In this discussion board provide us with a link to ...

Frtilized grasslands diversity 6930 and richness

Fertilized grasslands: diversity = .6930 and richness = 4 Unfertilized grassland: diversity = .7075 and richness = 10 Answer the question by the following: 1. Which grassland has the higher species richness, and is it a ...

What is the relationship between the structure of a blood

What is the relationship between the structure of a blood vessel and blood pressure? What is the relationship between the structure of a blood vessel and blood velocity? Describe the pathway of urine from production to e ...

The end products of both mitosis and meiosis is a set of

The end products of both mitosis and meiosis is a set of chromosomes. Explain the differences between the two sets. Suppose that Mendel had decided to use dogs for his experiments. What problems would he have had that he ...

Discuss five different techniques used in the preparation

Discuss five different techniques used in the preparation of fermented products. please cite where you got the information please.

Assignmentuse what we have learned about biomimicrycreate a

Assignment Use what we have learned about biomimicry Create a 1 page document- "Working Towards a Sustainable Society" Project: • Develop a thesis statement- then back that up with ways we can get there. • Describe the c ...

Can testosterone cross the plasma membrane what type of

Can testosterone cross the plasma membrane? What type of transport would it require?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen