Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

The plasma membranes of polarized epithelial cells such as

The plasma membranes of polarized epithelial cells, such as those found in thetubules of the nephrons in the kidney, are divided into apical and basolateraldomains. How are these two domains different and how do the diff ...

1 how does triclosan affect fertilization2 what are human

1. How does triclosan affect fertilization? 2. What are human generated sources of triclosan in the ocean?

Track the ingestion and digestion of a ham and cheese

Track the ingestion and digestion of a ham and cheese sandwich on whole wheat bread with lettuce, green pepper, and tomatoes. Describe the fate of this sandwich from the time you eat it. Be very detailed as to the digest ...

Select a current news item pertaining to an ethical

Select a current news item pertaining to an ethical situation in the Middle East that has arisen in a business or non-profit organization. Describe the situation and the organization. Determine what made or makes this si ...

Microbiology1 for what specific purpose was gram staining

Microbiology 1. For what specific purpose was gram staining developed for? what is it used for today? 2. Why is the presence of air bubbles a sign of contamination? 3. Why is a gram stain helpful when monitoring bacteria ...

When we activate multiple motor units their individual

When we activate multiple motor units their individual force combine to produce a greater force through what?

Environmental science final projectcreate hour to hour and

Environmental Science Final Project Create hour to hour and half long POWER POINT lecture (20-25 slides) using the following topics: Human Population Dynamics, Recent Climate Change, Ozone in the Atmosphere and they Hyrd ...

Book reviewbook criteria that should go without sayingthe

BOOK review: Book criteria that should go without saying: The book must be  non fiction. The book must be about  Astronomy .  The book cannot be the textbook.  Book Reviews must be at least two pages.

What fundamental assumption underlies the concept of an

What fundamental assumption underlies the concept of an ocean commons?

Identify the alga known for biological activity called

Identify the alga known for biological activity called bioluminescence?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen