Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

How do we call insect which are responsible for

How do we call insect which are responsible for transmitting diseases?

A photon of ultraviolet light hits double-stranded dna and

A photon of ultraviolet light hits double-stranded DNA and creates a covalent cross-link between adjacent thymines in the same strand (a thymine dimer). What is likely to happen? a-The DNA strand with the thymine dimer w ...

Immune and musculoskeletal diseasesresearch an autoimmune

Immune and Musculoskeletal Diseases Research an autoimmune disease that affects the musculoskeletal system. Write a 2-page paper. Address the following in the paper: The pertinent information on both the immune and muscu ...

Research and briefly describe a real world example about

Research and briefly describe a real world example about acid rain affects plants. Be sure to demonstrate how pH contributes to the outcome, and proposed solutions. Descriptions should be approximately 2-3 paragraphs. In ...

Please refer to the following interactive map as you

Please refer to the following interactive map as you complete this activity: http://worldpopulationhistory.org/map/2050/mercator/1/0/25/  Here are instructions for how to read the map: http://worldpopulationhistory.org/h ...

Lion can you please describe some adaptations that that

Lion: can you please describe some adaptations that that species developed that allow them to survive in their native habitat?

Lake stratificationhow does heat affect the tripariat

Lake Stratification: How does heat affect the tripariat thermal structure of a lake (epiliminion, thermocline and hypolimnion) during the summer and does the application of wind change this?

Book reviewbook criteria that should go without sayingthe

BOOK review: Book criteria that should go without saying: The book must be  non fiction. The book must be about  Astronomy .  The book cannot be the textbook.  Book Reviews must be at least two pages.

Please describe four different categories of tissue

Please describe four different categories of tissue engineering strategies for repairing bone and cartilage injuries separately, and compare the advantages and disadvantages of these strategies.

Familial hypercholesterolemia is associated with increased

Familial hypercholesterolemia is associated with increased riskfor heart attacks at a young age. What kind of clinical test canyou use to test for this disease? What would be the expectedresult? Explain the biochemical p ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro