Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

You receive 12 samples in your laboratory for genetic

You receive 12 samples in your laboratory for genetic screening. The samples form two families. The first family is composed of samples: 1(Mom Smith); 2 (Smith Son 1); 3(Smith Daughter 1); 4(Smith Son 2); 5(Smith Son 3); ...

Provide a 15 page single space in apa style reflection of

Provide a 1.5 page "single space" in APA style reflection of the video (Escape Fire The Fight to Rescue American Healthcare) https://www.youtube.com/watch?v=qkZlFMuVShE Respond to each of the following statements based o ...

Microscope lab-in our world cells come in two basic

Microscope Lab- In our world Cells come in two basic types- Prokaryotic Cells - Bacterial & Archaea Eukaryotic Cells - Plant, Animal, Protist, and Fungi (Yeasts are single celled fungi) http://study.com/academy/lesson/eu ...

1 the results of the study of the occurrence of

1. The results of the study of the occurrence of tuberculosis (TB) in a village in Malawi are given in the table below. All individuals in the village were examined during two surveys made two years apart. Assume that th ...

Physiology learning planfor your selected topic you are the

Physiology Learning Plan For your selected topic: You are the nephrology nursing educator working with new mill Topics -  GFR -  Removal of metabolic wastes -  Excretion of drugs and toxins -  Total body fluid volume and ...

Part a answer each of the following questions in one or two

Part A: Answer each of the following questions in one or two paragraphs. 1. Create two Punnett squares to display the outcome of the Fl generation and F2 gener¬ation from one of Mendel's experiments with pea plants. Use ...

One important aspect of understanding health care in the us

One important aspect of understanding health care in the U.S. involves an analysis of the "Key Indexes of Health and Disease," as they are termed. Review the material on this topic in your textbook and other sources, and ...

Part anbspdefine each vocabulary word in the following

Part A  Define each vocabulary word in the following table. Use your textbooks or an outside source as references. Provide examples where requested, use complete sentences, and be clear and concise when explaining your a ...

Discussionmuch of health assessment planning evaluation and

Discussion Much of health assessment, planning, evaluation, and policy making depend on communication. How can the Shannon-Weaver communications model be applied to these? What noise (interruptions or barriers) could sta ...

For the optimal temperature experiment which

For the optimal temperature experiment, which enzyme/substrate pair did you use? List your results for the absorbance at one minute when the temperature was 10, 20, 30, 40, 50, 60, 70 and 80 degrees. Based on your result ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate