Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

Please read instructions carefully 4-5 body page paper must

PLEASE READ INSTRUCTIONS CAREFULLY: 4-5 body page paper, must include a title and reference page, CITE PROPERLY,  I run all papers through turnitin website before i accept them which means you paper can only have 10-15% ...

Environmental science final projectcreate hour to hour and

Environmental Science Final Project Create hour to hour and half long POWER POINT lecture (20-25 slides) using the following topics: Human Population Dynamics, Recent Climate Change, Ozone in the Atmosphere and they Hyrd ...

Bacterial srnas activate and repress translation by

Bacterial sRNA's activate and repress translation by exposing or covering RBS (ribosome binding site) on mRNA. Riboswitches also activate and repress translation by exposing or covering RBS on mRNA. How do these two regu ...

Assignmentshort answeressay write your answers and submit

Assignment Short Answer ESSAY. Write your answers and submit assignment via the attachment. Please be specific and use examples from the textbook when appropriate 1) What 4 factors do you think should be taken into consi ...

During the separation of the different photosynthetic

During the separation of the different photosynthetic pigments of spinach by paper chromatography, how did you know which of the pigments was the least polar? It travelled the farthest on the paper (was the first pigment ...

Plants pend towards the source of of light on account of

Plants pend towards the source of of light on account of the movement curvature called?

What are centennial park nsw sydney australia the water

What are Centennial Park (NSW Sydney Australia) the water cycle management initiatives?(stormwater management, stormwater reuse, water quality monitoring )?

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

The a and b loci are 10 cm apart a plant with a genotype

The A and B loci are 10 cM apart. A plant with a genotype aaBB is crossed to plant with a genotype of AAbb. If an F1 plant is self pollinated, what proportion of the progeny will be homozygous dominant or homozygous rece ...

Microbiology1 for what specific purpose was gram staining

Microbiology 1. For what specific purpose was gram staining developed for? what is it used for today? 2. Why is the presence of air bubbles a sign of contamination? 3. Why is a gram stain helpful when monitoring bacteria ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro