Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

Select one chronic illness that could be diagnosed early in

Select one chronic illness that could be diagnosed early in life, such as asthma, diabetes, or rheumatoid arthritis. Follow a person with this chronic illness through the lifespan, discussing how treatment approaches wou ...

Clearly explain why health outcome is so much more than a

Clearly explain why health outcome is so much more than a combination of health care, individual behaviors, and/or genetics?

Assignmentselect an example of an advancement made in

Assignment Select an example of an advancement made in biotechnology (e.g. pharmacogenetics, stem cells, GMOs, de-extinction, etc.). Describe the specific advancement and what contribution it brings to society. For full ...

A child is born with a genetic disorder in which there is a

A child is born with a genetic disorder in which there is a deletion of part of a chromosome, and the child is predicted to be severely mentally retard. Which diagnosis should the nurse expect to see on the infant s char ...

Why is a sucrose-phosphate buffer used in preparation of

Why is a sucrose-phosphate buffer used in preparation of liver homogenate?

Please help me with these questions1 describe how sex is

Please Help me with these questions: 1. Describe how sex is determined in humans 2. Describe what sex linkage is and give an example 3. Define dosage compensation. 4. Define nondisjunction and describe a scenario in whic ...

1 e coli is a shortened name for a bacterium that lives in

1. E coli is a shortened name for a bacterium that lives in our gut. According to the rules of binomial nomenclature it is properly written as _______________. a. Escherichia COLI b. Escherichia Coli c. Escherichia coli ...

Topic genomicsquestion describe how the use of genetic

Topic: Genomics Question: Describe how the use of genetic knowledge can change the course of disease. What are the implications of the prolific use of genetic knowledge for the intervention of disease? Should there be an ...

What is the difference between mortality and reproductive

What is the difference between mortality and reproductive rates? Do you think that they equally make an impact on population growth? If yes or no, why?

How many neutrons does element x have if its atomic number

How many neutrons does element x have if it's atomic number is 42 and it's mass number is 154?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro