Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

The branch of agriculture which deals with the feeding

The branch of agriculture which deals with the feeding, shelter, health and breeding of the domestic animals is called?

A man and a woman both have polydactyly ie six fingers on

A man and a woman both have polydactyly (i.e., six fingers on each hand), a trait which is determined in this example by a single gene. They have four children, none of whom have polydactyly. What is the probability thei ...

Fluid electrolyte and acidbase balancedescribe the

Fluid, Electrolyte and Acid/Base Balance Describe the physiological roles of sodium, potassium, calcium, chloride, and phosphates. State the term for an excess or deficiency of each electrolyte and describe the consequen ...

1 describe the formation of a cp air mass and then discuss

1. Describe the formation of a cP air mass and then discuss the typical weather it produces and the changes it undergoes as it travels across the Great Lakes and moves southward. 2. Describe the typical life cycle of a m ...

Identify the alga known for biological activity called

Identify the alga known for biological activity called bioluminescence?

1 starting with the umbilical vein listchart the general

1) Starting with the umbilical vein, list/chart the general flow of blood through the fetus of a pig. 2) What special features of the lung make it a useful organ for gas exchange?

1 how does triclosan affect fertilization2 what are human

1. How does triclosan affect fertilization? 2. What are human generated sources of triclosan in the ocean?

List and describe different sediments that can be seen in

List and describe different sediments that can be seen in urine and differentiate between normal and abnormal sediments.

Write a 500-750 word essay about globalwarming that

Write a 500-750 word essay about globalwarming that addresses the following points: 1. What is global warming? 2. Describe how human activities impact globalwarming 3. Explain what an individual can do tominimize his/her ...

Determining whether clean groundwater has become dirty and

Determining whether clean groundwater has become dirty and what caused any contamination is a complex pursuit. Stephen Osborn and three colleagues from Duke University set out to learn whether drinking water was really b ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen