Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

Are there some bacteria that are not easily stained by the

Are there some bacteria that are not easily stained by the gram stain? Can you give an example of a bacterium that might not show up as gram-positive or gram-negative after being stained by Gram's method?

Generally aneuploidies are caused by the impaired

Generally, aneuploidies are caused by the impaired assortment of chromosomes during meiosis. For example, they are caused when the homologous chromosomes of pair 21 do not separate and, therefore, gametes with two chromo ...

There is a common misconception that traditional taxonomy

There is a common misconception that traditional taxonomy is based on morphology, while cladistics is based on genetic data. How is this misconception incorrect?

Discuss the similarities and differences between arteries

Discuss the similarities and differences between arteries, veins, and lymphatic vessels. Be sure to include size, tissue layers, and any other structural components.

Scientific advances are pointing researchers to new ideas

Scientific advances are pointing researchers to new ideas about how to reduce the side effects of epilepsy medications and improve therapy options for those resistant to current medications. Ongoing studies in animals an ...

28 year old female with 2 day history of urinary frequency

28 year old female with 2 day history of urinary frequency, burning and pain upon urination, lower abdominal pain and vaginal discharge history of recurrent UTIs, chlamydia, gonorrhea x2 she has 3 children.

How does dna polymerase facilitate the pcr

How does DNA polymerase facilitate the PCR reaction?

What would happen to a patient with huntingtons if you

What would happen to a patient with Huntington's if you somehow manage to block the promoter region of the huntingtin gene?

What do we call the transfer of pollen grains from anther

What do we call the transfer of pollen grains from anther to the stigma in plants?

What is the difference between mortality and reproductive

What is the difference between mortality and reproductive rates? Do you think that they equally make an impact on population growth? If yes or no, why?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen