Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

Briefly describe the changes in lipid composition of

Briefly describe the changes in lipid composition of amniotic fluid before and during fetal lung maturation.

Describe how the central nervous system is protected from

Describe how the central nervous system is protected from injury. List the components of a spinal reflex arc. Describe the function of each component.

Does the environment exert an influence on the phenotype

Does the environment exert an influence on the phenotype? What are some examples of phenotypical characteristics that present two or more varieties and of phenotypical features that do not vary? In relation to the genes ...

Use the following link Use the following link

Use the following link (http://www.ted.com/playlists/144/should_we_redesign_humans) to access a playlist of videos oncurrent developments in synthetic biology. Choose three videos to watch, and write a case study of at l ...

Formatnbsp at least one page in length 1-inch margins size

Format:   At least one page in length, 1-inch margins, size 11 font, double spaced.  Sources:   All sources must be properly cited within  and  at end of paper. Use MLA or APA style. Please do the following: Go to the in ...

What type of reproduction uses part of a plant body becomes

What type of reproduction uses part of a plant body becomes separated off to give rise to new individuals?

Pleasenbspprovide an answer and your supporting

Please  provide an answer and your supporting explanation/reasoning for one  of the following questions: 1. What is the epigenome?  2. Why is important to study it?

For training and development classcompare and contrast two

(For Training and Development Class) Compare and contrast two learning theories. Which one do you believe is most effective? Why? Your response should be at least 200 words in length.

Why was there such a diversity of species in such a small

Why was there such a diversity of species in such a small area? Could these species have been modified from an ancestral form that arrived on the Galápagos Islands shortly after the islands were formed?

1 keeping in mind that lying is stressful what externally

1. Keeping in mind that lying is stressful, what externally detectable signs might a lie detector identify, assuming it reliability? 2. What would be the effect on the circulatory system if a person received a massive do ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro