Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)
vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928340

Have any Question? 


Related Questions in Biology

In this assignment you will select a fermented food or

In this assignment, you will select a fermented food or beverage from the list provided. After making your selection, you will prepare a 3 page written report about it. The report should include historical information re ...

How do gap junctions function with the intercellular

How do gap junctions function with the intercellular diffusion of sodium

Parents were concerned about their 16-year-old son for the

Parents were concerned about their 16-year-old son for the following reasons: he had no deepening of his voice, scanty pubic and axillary hair growth, absence of beard and mustache growth, small penis, poor muscular deve ...

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

Explain why nbspin psoriasis is an nbspthe cells in the

Explain why  in Psoriasis is an  the cells in the dermis and epidermis thickened. Decreased cell maturation occurs in psoriasis  as a result of? Reference/s  must be provided to make  sure the  information  you are tutor ...

The a and b loci are 10 cm apart a plant with a genotype

The A and B loci are 10 cM apart. A plant with a genotype aaBB is crossed to plant with a genotype of AAbb. If an F1 plant is self pollinated, what proportion of the progeny will be homozygous dominant or homozygous rece ...

Bacteria would be an example of an organism that undergoes

Bacteria would be an example of an organism that undergoes asexual reproduction. How would these organisms obtain genetic diversity if they need to?

What is the probability of a cross resulting in white

What is the probability of a cross resulting in white offspring when two heterozygous purple pea plants (e.g. Pp x Pp) are bred? What is the genotype for this offspring?

Digestion is an important process in the human bodya

Digestion is an important process in the human body. a) Identify and describe the digestive processes. b) Consider the mouth, stomach, small intestines and large intestines - identify the digestive enzymes that are prese ...

Discuss the concept of risk and diversification and

Discuss the concept of risk and diversification and highlight types of risk correlation within portfolio with more than one asset?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro