Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

Explain the hierarchy of plant structure using the root as

Explain the hierarchy of plant structure using the root as an example organ and follow it through each stage until you reach the level of cell. Only use the vascular tissue systems.

Steroids hormonessuch as testosterone are derived from

Steroids hormones,such as testosterone, are derived from cholesterol. What type of macromolecule are they?

Answer the following questionwhat is the domain and kingdom

Answer the following question: What is the domain and kingdom for an organism that has a nucleus, is not motile, and does not perform photosynthesis? What is taxonomy? What role does this serve? How does taxonomy assist ...

Which genetic material was discovered by robert brown and

Which genetic material was discovered by Robert Brown and in which year.

What are the differences between the roles of mainstream

What are the differences between the roles of mainstream and alternative health care providers? Do you feel that these types of health care workers are given the respect as professionals that they deserve? Why, or why no ...

1 mediterranean climates like those in central california

1. Mediterranean Climates, like those in Central California, experience extremely hot and dry summers and relatively cool and moist winters. Relate the soil-water balance to the growth strategies of plants in this region ...

Do some research and describe at least one specific example

Do some research and describe at least one specific example where antibiotic overuse has resulted in a negative effect. What was the effect of this overuse? How could this have been prevented? What do you think about ant ...

1 describe the three classes of carcinogens and their sub

1. Describe the three classes of carcinogens and their sub classes; describe the role each plays in the cancer process and give chemical examples. 2. Describe six points in the cancer process where the process can be inh ...

Clearly explain why health outcome is so much more than a

Clearly explain why health outcome is so much more than a combination of health care, individual behaviors, and/or genetics?

Describe the purpose of the human genome project and how it

Describe the purpose of the Human Genome project and how it was achieved. Form a hypothesis of future research that could benefit from the HGP.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro