I know that the factor v leiden mutation is at the 1691, Ask an Expert

Academics

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M925015

Have any Question?Write your Review or question?

Related Questions in Biology

If the atomic number of an element is 12 and the atomic

If the atomic number of an element is 12 and the atomic mass is 25. How many protons are there in the nucleus? How many neutrons are there in the nucleus? How many electrons are in the atom?

Instructions address each question below as it relates to

Instructions: Address each question below as it relates to the caw study given. A patient was brought to the Emergency Department by ambulance with two arrow wounds. One arrow is still in the patient on the left side; en ...

The human microbiome and its relationship to human health

The human microbiome and its relationship to human health, what aspect to the human microbiome is vital?

Suppose a man carries a very common dominant mutation for a

Suppose a man carries a very common dominant mutation for a deadly muscular disease that doesn't show up until people are usually over 50 years of age (he has the disease). He and his wife are expecting their first child ...

What is the process of turning polynucleotides into

What is the process of turning polynucleotides into proteins?

Bio toxicology lab assignment -based on the available

Bio Toxicology Lab Assignment - Based on the available information provided to you, lab work and lab reports, answer the following questions. 1) Potentially harmful chemicals are introduced into our environment every day ...

What types of molecular interactions occur between the

What types of molecular interactions occur between the active site and the substrate?

A doctor is testing the effectiveness of a new antibiotic

A doctor is testing the effectiveness of a new antibiotic. He gives the first group of patients a placebo, a second group receives antibiotic A while the third group receives antibiotic B. Which of the groups is consider ...

Discussion bad blood a case study of the tuskegee syphilis

Discussion Bad Blood: A Case Study of the Tuskegee Syphilis Project. Photo by Department of Health, Education, and Welfare. Public Health Service. Health Services and Mental Health Administration. Center for Disease Cont ...

Why biologically is evolved resistance to crop pests

Why, biologically, is evolved resistance to crop pests inevitable?

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert