Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

Explain the hierarchy of plant structure using the root as

Explain the hierarchy of plant structure using the root as an example organ and follow it through each stage until you reach the level of cell. Only use the vascular tissue systems.

Phylum arthropodathe earths largest phylum is arthropoda

Phylum Arthropoda The Earth's largest phylum is Arthropoda, including centipedes, millipedes, crustaceans, and insects. The insects have shown to be a particularly successful class within the phylum. What biological char ...

1 much pharmaceutical research targets developing

1. Much pharmaceutical research targets developing anti-cancer drugs that can effectively stimulate the methylation of DNA. Formulate a possible hypothesis to explain why DNA methylation might be an effective anticancer ...

Focus on case studies in neurologyfor this assignment you

Focus on Case Studies in Neurology For this assignment you will respond to three case studies. What is a Case Study? "A case study is a narrative used to help you practice real-life analysis and communication skills. It ...

Question 1future drugs and vaccines for the use against

Question 1 Future drugs and vaccines for the use against Ebola Pick an experimental drug, vaccine or other treatment that is being considered in the fight against Ebola. http://www.cdc.gov/vhf/ebola/outbreaks/2014-west-a ...

A 74-year-old woman is transported to a regional burn

A 74-year-old woman is transported to a regional burn center after being rescued from a house fire. Apparently, a space heater was knocked over and an area rug caught fire. The fire quickly spread throughout the house. S ...

In an experimental template having perfectly placed 5

In an experimental template having perfectly placed 5 nucleosomes there is a single EcoR1 site buried near dyad axis of the 3rd nucleosome. Is it possible for a modeller to make this site accessible without disturbing an ...

28 year old female with 2 day history of urinary frequency

28 year old female with 2 day history of urinary frequency, burning and pain upon urination, lower abdominal pain and vaginal discharge history of recurrent UTIs, chlamydia, gonorrhea x2 she has 3 children.

Looking for assistance with the below information regarding

Looking for assistance with the below information regarding alternatives to landfills.  References are needed. Alternatives to Landfills The use of sanitary landfills for burial of municipal solid wastes has been the pri ...

Lets say that robert baratheon despite being king was

Let's say that Robert Baratheon, despite being king, was unlucky enough to be heterozygous from Huntington's disease and heterozygous polycystic kidney disease-2 (caused by a mutation in the Polycystin-2 gene). However, ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro