Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

1 explain the normal hormonal control of male sexual

1) Explain the normal hormonal control of male sexual development by the hypothalamus pituitary-gonadal axis. 2) Are there other hormones that might influence reproductive maturation? Which ones and how do they affect gr ...

Create a patient scenario but dont give away the

Create a patient scenario but don't give away the disease.  First explain the terms opportunistic and true pathogen. Also differentiate between syndrome, signs and symptoms of disease so everyone will have an idea of wha ...

Give the other component that makes up the cell membrane

Give the other component that makes up the cell membrane apart from the protein layer?

Biology assignmenteffects on the environmentnote online

Biology Assignment "Effects on the Environment" Note: Online students, please respond to one of the following four bulleted items. • Discuss three positive and three negative impacts of humans on the biosphere. Which pos ...

Anakin with a genotype of ao rhd- has fraternal twins luke

Anakin with a genotype of A/O RhD+/- has fraternal twins (Luke and Leia) with Padme, whose genotype is A/O RhD-/-. Luke and his uncle Owen have never had their blood type tested. Leia has her blood typed and it is A RhD+ ...

Describe the major events involved in image formation on

Describe the major events involved in image formation on the retina, and list in the correct order the components of the eye that light passes through on its way to the retina. Describe the specific consequences of any a ...

Arrange the gram staining steps in their correct order only

Arrange the gram staining steps in their correct order (only write the correct alphabetical order. Write the answer as the correct order of letters. a. Saffranine b. Air dry c. Heat fix d. Crystal violet e. Decolorize f. ...

What is the relationship between the fields of taxonomy

What is the relationship between the fields of taxonomy, systematics and cladistics?

For this assignment you will think about your individual

For this Assignment you will think about your individual health and health risks. What genetic diseases or problems might you face during your lifetime? Predisposition to heart disease, breast cancer, diabetes? You may c ...

What are the two groups of defense mechanism of the body

What are the two groups of defense mechanism of the body against foreign or harmful agents? What is the difference between them? How can the immune memory lead to the efficacy of vaccines and also produce allergies?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen