Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

A 26-year-old business executive complained of a dull pain

A 26-year-old business executive complained of a dull pain (heartburn) behind the sternum. The painwas postprandial (occurred after meals) and disappeared within a few minutes to an hour. It was oftenassociated with belc ...

Due to the prospect of interplanetary travel how would you

Due to the prospect of interplanetary travel, how would you attempt to  Isolate  and  identify  a bacterial infection acquired on another planet. This bacteria is unknown to use and does not appear in  Bergey's  or the  ...

Hypophosphatemia is a dominant genetic disorder caused by a

Hypophosphatemia is a dominant genetic disorder caused by a deficiency of phosphates in the blood. Asssuming the other parent is free of the disorder, males with the disorder will pass it on to their daughters but not th ...

Part aprepare a powerpoint slides meeting below grading

PART A Prepare a powerpoint slides meeting below grading criteria covering topic Isoflavones and Polymethoxyflavones using recent original articles one from cell, frontier and nature. -recent articles related to the mech ...

The a and b loci are 10 cm apart a plant with a genotype

The A and B loci are 10 cM apart. A plant with a genotype aaBB is crossed to plant with a genotype of AAbb. If an F1 plant is self pollinated, what proportion of the progeny will be homozygous dominant or homozygous rece ...

Name a process that occurs when dna is released by a broken

Name a process that occurs when DNA is released by a broken or lysed bacterium is taken up by another bacterium through its cell membrane giving this bacterium new traits

Explain how these electrical currents of epsps and ipsps

Explain how these electrical currents of EPSPs and IPSPs are used in spatial and temporal summation to initiate or inhibit the generation of an action potential.

Biol 101 study guide quizquiz preparation tasks11 your

BIOL 101 STUDY GUIDE: QUIZ Quiz Preparation Tasks: 11 Your Answers and Notes Elegant Responsiveness A hormone that controls a person's appetite might bind to ____________ proteins on membranes in the brain. What is the t ...

Do some research and describe at least one specific example

Do some research and describe at least one specific example where antibiotic overuse has resulted in a negative effect. What was the effect of this overuse? How could this have been prevented? What do you think about ant ...

State one example of animals having a single opening to the

State one example of animals having a single opening to the outside that serves both as a mouth as well as the Amy's is?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro