Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

You are caring for a patient who is extremely ill but might

You are caring for a patient who is extremely ill, but might be helped if he could get access to a drug that is already approved in Europe. Write a paragraph describing why it is sometimes a good thing for drugs not to b ...

Differentiate between ectoderm mesoderm and endoderm and

Differentiate between ectoderm, mesoderm and endoderm and list what tissues arise from each.

Jillian is thrown from a horse she strikes the ground with

Jillian is thrown from a horse. She strikes the ground with her chin, causing severehyperextensionof the neck. Emergency medical technicians properly immobilize her neck and transport her to a hospital, but she dies 5 mi ...

Topic cleveland clinicfor the final portfolio project you

Topic: Cleveland Clinic For the final Portfolio Project you will submit a written paper developing an organization's strategic marketing plan that you could share with the organization's board of directors.  You may wish ...

What is one example of an organism that belongs to

What is one example of an organism that belongs to platyhelminthes?

Explain why the removal of great sharks poses a threat to

Explain why the removal of great sharks poses a threat to bay scallops on the Atlantic Coast of North America, despite the fact that large sharks do not feed on scallops. Include the concept of a trophic cascade in your ...

Assignment150 word minimum for question 1 only any

Assignment 150 word minimum for question #1 ONLY. Any materials used in answering the questions must be put in your own words and the reference(s) must be properly cited. 1. According to some scientists, in developing co ...

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

Ocean systemsaccording to the law of conservation of energy

Ocean Systems According to the law of conservation of energy, energy cannot be created or destroyed, but it can change from one form to another 1. A boy doing a cannonball into the pool. He went from potential to kinetic ...

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen