Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

Depletion of nadph and glutathione in cells is considered

Depletion of NADPH and glutathione in cells is considered harmful. Explain why, and give an example of a chemical that may deplete NADPH and glutathione through interaction with the FMO enzyme. The FMO3 enzyme has an imp ...

Assignmentsimmunology1st assignmentsection ithe following

Assignments Immunology 1st Assignment Section I. The following Topics 1-3 (of 4) cover the cell isolation protocols from Units 1 & 2: Assigned Appendix readings; Isolation of human monocytes by double gradient centrifuga ...

Lab an introduction to genetic processespart a dna

Lab: An Introduction to Genetic Processes Part A: DNA Replication and Protein Synthesis and Sources of Variability Exercise Exercise 1 . Illustrate your understanding of complimentary bases and DNA Replication by providi ...

Orphan drugs for rare diseases1go Orphan Drugs for Rare Diseases 1. Go

Orphan Drugs for Rare Diseases 1. Go to:http://www.accessdata.fda.gov/scripts/opdlisting/oopd/index.cfm a. In the start date, type 01/01/2010. b. In the "Search Results", pull down "Only Approved Products". c. In the "So ...

Researchers are working to develop biofuels to free us from

Researchers are working to develop biofuels to free us from dependence on fossil fuels. Based on what you know about cellulose, what do you predict are the major advantage and disadvantage of using cellulose-rich plant m ...

Assignment anatomy amp physiologydirections be sure to

ASSIGNMENT: Anatomy & Physiology Directions: Be sure to save an electronic copy of your answer before submitting it to Ashworth College for grading. Unless otherwise stated, answer in complete sentences, and be sure to u ...

Unit ii essay create an imaginary profile of a family of

Unit II Essay Create an imaginary profile of a family of three to four members providing details such as sex, age, health status,nutritional status, and medications for each member of the family. Develop a scenario in wh ...

Assignment 11-partial hydrogenation of healthy cis

Assignment 1 1-Partial hydrogenation of (healthy) cis unsaturated fats produces trans fatty acids. Most of the trans fats produced by the hydrogentation process are classified as saturated fats even though they are still ...

Microscope lab-in our world cells come in two basic

Microscope Lab- In our world Cells come in two basic types- Prokaryotic Cells - Bacterial & Archaea Eukaryotic Cells - Plant, Animal, Protist, and Fungi (Yeasts are single celled fungi) http://study.com/academy/lesson/eu ...

Chose a topic and answer the questionsthe topic is

Chose a topic and answer the questions The topic is : Metabolic rate measures and methods Prompts: 1. What is the method? General information about the methods. 1. Why would a researcher use this method? The particular f ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate