Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

Topic 1 discussion topiclist four areas of negligence for

Topic 1: Discussion topic List four areas of negligence for allied health professionals. Discuss the standard of care in each area, and how that standard can be applied to the healthcare facility.

Describe how the central nervous system is protected from

Describe how the central nervous system is protected from injury. List the components of a spinal reflex arc. Describe the function of each component.

Your friend bruce calls in a panic he has just come from

Your friend Bruce calls in a panic. He has just come from the doctor and been diagnosed with a bacterial infection. The doctor told him not to worry; his B cells will take care of it in no time! Knowing that you are stud ...

Identical twins jan and fran were very close sisters so

Identical twins Jan and Fran were very close sisters. So when Jan died suddenly, Fran moved in to help take care of Jan's daughter (her neice), Millie. Some time later Fran married her brother in law and became Millie's ...

Of the four chambers of the human heart which has the

Of the four chambers of the human heart, which has the thickest walls, and why? Why can you not catch the same cold twice, but a new cold will make you sick for a week or two? What is the key step in spermatogenesis that ...

Color blindness is an x-linked recessive trait a

Color blindness is an X-linked recessive trait. A color-blind man has a daughter with normal color vision. The daughter marries a man who has normal color vision. What is the expected phenotypic ratio of their children? ...

Problem 1 the schlogl modelthis model is famous for its

Problem 1: The Schlogl Model This model is famous for its bistable steady-state distribution. The reactions are              c1 B1 + 2X ? 3X,              c2      c3 B2 ? X,      c4 where B 1 and B 2 denote buffered spec ...

Caleb has a lung infection caused by the bacterium

Caleb has a lung infection caused by the bacterium Streptococcus pneumoniae, an extracellular pathogen. What type of adaptive immune response (humoral or cell mediated) will Caleb's immune system have to the bacteria? Su ...

Which type of reproduction occurs through the formation of

Which type of reproduction occurs through the formation of different types of spores in favourable and unfavourable conditions by division of the protoplast

1 starting with the umbilical vein listchart the general

1) Starting with the umbilical vein, list/chart the general flow of blood through the fetus of a pig. 2) What special features of the lung make it a useful organ for gas exchange?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro