Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

Discuss the concept of risk and diversification and

Discuss the concept of risk and diversification and highlight types of risk correlation within portfolio with more than one asset?

You read in the newspaper about a recently approved

You read in the newspaper about a recently approved prescription drug that has suddenly been withdrawn from the market because of severe adverse effects and several deaths. Discuss why this can still occur despite years ...

Transgenic plants can be given characteristics that are

Transgenic plants can be given characteristics that are agriculturally useful such as resistance to herbicides. Bt corn is one example. Identify some advantages and problems associated with genetically modified Bt corn. ...

The branch of agriculture which deals with the feeding

The branch of agriculture which deals with the feeding, shelter, health and breeding of the domestic animals is called?

Phylum arthropodathe earths largest phylum is arthropoda

Phylum Arthropoda The Earth's largest phylum is Arthropoda, including centipedes, millipedes, crustaceans, and insects. The insects have shown to be a particularly successful class within the phylum. What biological char ...

Look up in your textbook or internet source information on

Look up in your textbook or internet source information on how each of these drugs works on the cellular level and complete the chart below. Be sure to note your source of information. DRUG HOW IT WORKS AT CELLULAR LEVEL ...

In the united states in 2006 the total population was

In the United States in 2006, the total population was approximately 298,363,000. Of these, fires killed approximately 3,100 people. For a person in the United States in 2006, what was the risk of being killed by a fire? ...

Identify the single major risk factor associated with the

Identify the single major risk factor associated with the reoccurrence of colon cancer.

Identifynbspan organism that lives within 50 miles of your

Identify  an organism that lives within 50 miles of your home. Write  a 1,050- to 1,400-word paper about how the organism has adapted to survive in their specific environment. Include the following points in your paper:  ...

You have been in hr for 8 years three weeks ago you joined

You have been in HR for 8 years. Three weeks ago you joined your third employer, Chicken Pluckers, Inc., as HR Manager. Chicken Pluckers is a family-owned, meat processing plant with 400 employees. Your new boss, the CEO ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen