Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

In beans yellow y is dominant to green y and smooth s is

In beans yellow (Y) is dominant to green (y) and smooth (S) is dominant to wrinkled (s). What are the possible genotypes for the offspring of the following cross: Yyss and Yyss.  YYss, yyss  YYSS, YYSs, YYss, YySS, YySs, ...

3 to 4 line sentences for responserecent estimates suggest

3 to 4 Line sentences for response: Recent estimates suggest that 70% of processed food in the US contains genetically modified ingredients, largely from genetically modified soy beans. Unlike many other countries, the U ...

What is photosynthesis and what is the pigment for it to

What is photosynthesis and what is the pigment for it to take place?

List the following in order from smallest to largest

List the following in order from smallest to largest: (Chromosome, DNA, Chromatin, Chromatid, Gene, Nucleotide)

Freckles f and six fingers s are dominant alleles in humans

Freckles (F) and six fingers (S) are dominant alleles in humans and the genes occur on different chromosomes. If an FfSs male and an FfSs female have a WHOLE BUNCH of kids, Here are the expected ratios below. 9: freckles ...

Which type of reproduction occurs through the formation of

Which type of reproduction occurs through the formation of different types of spores in favourable and unfavourable conditions by division of the protoplast

Explain how the decline in genetic diversity with distance

Explain how the decline in genetic diversity with distance from Africa supports the Out of Africa hypotheses.

Why is internalization important for respiration in animals

Why is internalization important for respiration in animals? and what does it mean?

What type of reproduction involves union of sex cells and

What type of reproduction involves union of sex cells and their nuclei?

Candy is a 13 year old who lives with her father and

Candy is a 13 year old who lives with her father and younger sister. Her mother died when Candy was 6 years old and her sister was 4 years old. Her father works a 12 hour shift full time to support himself and his daught ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen