Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTGCTAA- 3' (primer pr-990, nt (-)146 to (-) 127, intron 10).

I know that the factor v leiden mutation is at the 1,691 location, so where do the primers go, and what is (-) 146 to (-) 127? Does that mean the forward primer starts at 127 to 146 and the reverse at 1581 to 1602?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M925015

Have any Question? 


Related Questions in Biology

Using globe study results and other supporting data

Using GLOBE study results and other supporting data, determine what Japanese managers believe about their subordinates. How are these beliefs similar to those of the U.S. and European Managers? How are these beliefs diff ...

Which type of reproduction occurs through the formation of

Which type of reproduction occurs through the formation of different types of spores in favourable and unfavourable conditions by division of the protoplast

What is the state of the issue of genome engineering

What is the state of the issue of Genome engineering technology in Sweden? Are there laws governing the it? Is there a high level of controversy in Sweden over the ethical issues of Genome engineering technology? Why/why ...

Topic systemic pathophysiology of the respiratory and

Topic: Systemic Pathophysiology of the Respiratory and Gastrointestinal Systems Objective: Discuss a disease, condition or syndrome affecting the cardiovascular system and current research, events, or interesting facts a ...

Write a paper about pandainstruction is given belowbullyour

Write a paper about PANDA. Instruction is given below. • Your position paper should be from 3 pages in length! (Reference page excluded) • Provide evidence as to why the animal has become endangered and emphasize the eff ...

1 uterine contractions that are irregular and brief that

1) Uterine contractions that are irregular and brief that occur toward the end of gestation are called ________. 2) The hollow cavity within the blastocyst is the ________. 3) The process by which a viable embryo is form ...

Looking for assistance with the below information regarding

Looking for assistance with the below information regarding alternatives to landfills. References are needed. Alternatives to Landfills The use of sanitary landfills for burial of municipal solid wastes has been the prim ...

Assume the role of a research scientist who is applying for

Assume the role of a research scientist who is applying for grant money to fund research on ALS. Describe the particular area of research that you would investigate (drug-based therapies that would slow the progression o ...

Explain the influence of lifestyles socioeconomic status

Explain the influence of lifestyles, socioeconomic status, and disease management regarding the flu.

Phylum arthropodathe earths largest phylum is arthropoda

Phylum Arthropoda The Earth's largest phylum is Arthropoda, including centipedes, millipedes, crustaceans, and insects. The insects have shown to be a particularly successful class within the phylum. What biological char ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen