I. A double strand of DNA contains the following sequence. 5' AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3'
3' TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5'

a. Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT.

b. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame? Please indicate the start and stop codons in different colors.

II. Review blue-white screening in the website below: http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

You are cloning human insulin gene (INS) in the lab using a plasmid, pJET, that contains an ampicillin resistance marker and also a lacZ gene interrupted by a multiple cloning site. You transform the rDNA into competent E. coli cells by electroporation, then plated the transformed E. coli on agar plates containing ampicillin and X-Gal and waited one day until colonies are visible. You then use blue/white screening to help you identify clones that carry INS gene. You observe numerous blue and white colonies on the agar plate.

a. What do blue colonies signify? Briefly explain your answer.

b. Which colonies (blue, white, or both) would you want to pick for further analysis to check for the successful cloning of the INS gene? Briefly explain your answer.

c. If you forgot to add X-gal to the agar selection medium, how would the colonies that grow differ phenotypically from the ones that grow in plates with X-Gal? Briefly explain your answer.

d. If you forgot to add ampicillin to the agar selection medium, what other colonies would grow that won't normally grow in plates with ampicillin? What color would those other colonies most likely be?