How many dna fragments would be, Ask an Expert

Academics

How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence?

5' ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3'
3' TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5'

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M9215343

Have any Question?Write your Review or question?

Related Questions in Biology

The current scientific defination of standard temp and

The current scientific defination of standard temp and pressure (STP) is: 0 degrees C and 1.00 bar pressure of a gas, using ideal gas law calculate the volume In L occupied by 1 mol of an ideal gas under these condition( ...

Assignment -the upper-case blue letters are the 14th exon

Assignment - The upper-case, blue letters are the 14th exon (of 20) in the Hephl1 gene in mice. The lower-case (black) letters are from the flanking introns. The highlighted bases indicate primers that may be used to ge ...

A mother has a blood the child has type o mr white has type

A mother has A blood, the child has type O, Mr. White has type B blood, and Mr. Green has AB. Whose the father? Mr. White or Mr. Green; Either Mr. White or Mr. Green; Neither Mr. White or Mr. Green could be the father an ...

You have been allocated a cdna accession number from the

You have been allocated a cDNA accession number from the NCB' database (see table below on page 2). Your task is to design experimental strategies that will allow you to: clone the cDNA in different expression vectors us ...

Do polynucleotides make the proteins dna polymerase 1 dna

Do polynucleotides make the proteins DNA polymerase 1, DNA Polymerase 3, Helicase, SSB proteins, ligase and Primase?

Pleasehelp me to answer this question fill in the blankin

PLEASE help me to answer this question: Fill in the blank In sexually reproductive organisms, mutations must occur in the ________ in order to be passed on to the next generation.

A patient had abnormally low ch50 results ie abnormally low

A patient had abnormally low CH50 results (i.e., abnormally low lysis of antibody coated sheep red blood cells) would abnormally low levels of Bb explain the CH50 assay results? Why or Why not?

Calculate the concentrations at eqbm of h2co3 hco3- co32-

Calculate the concentrations at eqbm of H2CO3, HCO3-, CO32-, and H+ in a saturated aq solution of H2CO3 in which the original concentration of H2CO3 is 0.034M (Ka1= 4.3*10^-7, Ka2 = 4.8*10^-11)

Title titer mtl what do you mean when you refer to the

Title Titer MTL: what do you mean when you refer to the burst size of a phage? How will burst size affect your Titer?

Quesiton synthetic chromosomes transcriptomes and patents

Quesiton: "Synthetic chromosomes, Transcriptomes, and Patents on BRCA genes" For your primary post, please respond to one of the following three topics with a post of at least 125 words that addresses each point given in ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert