Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

1 starting with the umbilical vein listchart the general

1) Starting with the umbilical vein, list/chart the general flow of blood through the fetus of a pig. 2) What special features of the lung make it a useful organ for gas exchange?

Suppose you bring 100 pounds of groceries into your home

Suppose you bring 100 pounds of groceries into your home each week. Please estimate how many pounds of each type of waste leaves your home. Does this add up to 100 pounds? Where do the various forms end up?

Provide answers to the following in essay forma identify

Provide answers to the following in essay form. a) Identify three different general types of fossil fuels. b) Identify and discuss environmental problems that are associated with using these fossil fuels. c) Identify 3 t ...

Weve all had experiences where we have been frustrated by a

We've all had experiences where we have been frustrated by a decision that our supervisor made. You have probably blamed this decision on your boss being "closed-minded," "stubborn," or "pigheaded." But after reading the ...

Hans had had a strep throat two weeks before he was to

Hans had had a strep throat two weeks before he was to start anew job. He had to complete some work before he could resign fromhis old position so he ignored the bacterial infection. In thefirst week of his new job he no ...

A 74-year-old woman is transported to a regional burn

A 74-year-old woman is transported to a regional burn center after being rescued from a house fire. Apparently, a space heater was knocked over and an area rug caught fire. The fire quickly spread throughout the house. S ...

1 mediterranean climates like those in central california

1. Mediterranean Climates, like those in Central California, experience extremely hot and dry summers and relatively cool and moist winters. Relate the soil-water balance to the growth strategies of plants in this region ...

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

Explain why type abblood may be called the universal

Explain why type AB+blood may be called the "universal recipient" for blood transfusion. Explain why this would not be true if the transfusion required 6 units( about 3 liters) of blood.

Research the mode of inheritance for this diseasetrait why

Research the mode of inheritance for this disease/trait? Why? If you are not able to find a specific mode of inheritance, provide a hypothesis for the mode of inheritance. Explain your thinking here very thoroughly; this ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen