Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

Lab reportthe purpose of a biology lab report is to

Lab Report The purpose of a Biology lab report is to describe and analyze a laboratory experiment that explores a scientific concept so that other scientists might be able to replicate the experiment and investigate the ...

There are approximately 4000 dna sites in the yeast genome

There are approximately 4000 DNA sites in the yeast genome which could potentially bind the yeast transcription factor GAL4, but only 10 sites control genes necessary for galactose metabolism. In one chromatin immunoprec ...

What is the difference between cis-acting elements and

What is the difference between cis-acting elements and trans-acting factors in the regulation of DNA?

Genetics- epigeneticsread the below article if you think

Genetics- Epigenetics Read the below article. If you think that you've perceived any flaws, overstatements/unsupported conclusions, or if you were simply left wondering about experiments that could have been done but wer ...

Compare the composition of intracellular and extracellular

Compare the composition of intracellular and extracellular fluids.

Health records managementdirections be sure to save an

Health Records Management Directions : Be sure to save an electronic copy of your answer before submitting it to Ashworth College for grading. Unless otherwise stated, answer in complete sentences, and be sure to use cor ...

Can geneticists accurately predict the possibility of the

Can geneticists accurately predict the possibility of the inheritance of a genetic disease? Why or why not?

What are the two groups of defense mechanism of the body

What are the two groups of defense mechanism of the body against foreign or harmful agents? What is the difference between them? How can the immune memory lead to the efficacy of vaccines and also produce allergies?

Why was there such a diversity of species in such a small

Why was there such a diversity of species in such a small area? Could these species have been modified from an ancestral form that arrived on the Galápagos Islands shortly after the islands were formed?

Please refer to the following interactive map as you

Please refer to the following interactive map as you complete this activity: http://worldpopulationhistory.org/map/2050/mercator/1/0/25/  Here are instructions for how to read the map: http://worldpopulationhistory.org/h ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen