Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

You have formulated a hypothesis mangoes contain more

You have formulated a hypothesis: "Mangoes contain more vitamin C than oranges." To test this hypothesis you measure vitamin C levels in 20 oranges and 20 mangoes from trees that were grown in the same orchard under the ...

Ocean systemsaccording to the law of conservation of energy

Ocean Systems According to the law of conservation of energy, energy cannot be created or destroyed, but it can change from one form to another 1. A boy doing a cannonball into the pool. He went from potential to kinetic ...

Looking for assistance with the below information regarding

Looking for assistance with the below information regarding alternatives to landfills.  References are needed. Alternatives to Landfills The use of sanitary landfills for burial of municipal solid wastes has been the pri ...

Is it appropriate to say that all changes in the nucleotide

Is it appropriate to say that all changes in the nucleotide sequence of protein-encoding DNA result in new alleles? Explain. (This is sort of a judgment call. It depends on how broadly or narrowly you define the term all ...

Lets discuss the role of the intestinal microbiota in the

Let's discuss the role of the intestinal microbiota in the maintenance of health and the many opportunistic pathogens that cause disease when the delicate balance of normal microbiota in this region of the body is distur ...

Health records managementdirections be sure to save an

Health Records Management Directions : Be sure to save an electronic copy of your answer before submitting it to Ashworth College for grading. Unless otherwise stated, answer in complete sentences, and be sure to use cor ...

Clearly explain why health outcome is so much more than a

Clearly explain why health outcome is so much more than a combination of health care, individual behaviors, and/or genetics?

Phylum arthropodathe earths largest phylum is arthropoda

Phylum Arthropoda The Earth's largest phylum is Arthropoda, including centipedes, millipedes, crustaceans, and insects. The insects have shown to be a particularly successful class within the phylum. What biological char ...

Name six specimen types that are often tested in forensic

Name six specimen types that are often tested in forensic toxicology; e.g. blood. Under what circumstances is each specimen preferred? Methadone is used to help drug addicts break the cycle. How does methadone work and i ...

Topic 1 discussion topiclist four areas of negligence for

Topic 1: Discussion topic List four areas of negligence for allied health professionals. Discuss the standard of care in each area, and how that standard can be applied to the healthcare facility.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro