Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

The sheep dolly was the first animal cloned by

The sheep Dolly was the first animal cloned by transplanting the nucleus from a cell from an adult sheep into an egg of a donor sheep. Dolly appeared to grow normally for several years, but at age 6, she developed compli ...

Biology assignmenteffects on the environmentnote online

Biology Assignment "Effects on the Environment" Note: Online students, please respond to one of the following four bulleted items. • Discuss three positive and three negative impacts of humans on the biosphere. Which pos ...

Lion can you please describe some adaptations that that

Lion: can you please describe some adaptations that that species developed that allow them to survive in their native habitat?

Provide answers to the following in essay forma identify

Provide answers to the following in essay form. a) Identify three different general types of fossil fuels. b) Identify and discuss environmental problems that are associated with using these fossil fuels. c) Identify 3 t ...

Social unrest in west africa where sickle cell anemia is

Social unrest in West Africa, where Sickle cell anemia is most common, is forcing people to migrate to other countries. As a result, sickle cell anemia cases are rising in Europe and the US in recent years. Is the US pop ...

What is the role of abiotic factors in an ecosystem in

What is the role of abiotic factors in an ecosystem? In other words, how do they affect food webs? Why is it easier to classify protists by methods of nutrition and movement than by habitat (where they live)? Briefly exp ...

What is produced by fragmentation of the hyphae into their

What is produced by fragmentation of the hyphae into their component cells?

What policies at the local state or federal level eg

What policies at the local, state or federal level (e.g., education, transportation, employment, etc.) might reduce social and economic inequities? (b) What would a more equitable society look like? (c) Who can make it h ...

Microevolution is in some ways random while in other ways

Microevolution is in some ways random, while in other ways it is not. Explain what does this mean in regards to the potential of a mutation saving a species facing extinction?

Mitosis and meiosis are important processesa what does each

Mitosis and meiosis are important processes. a) What does each accomplish; b) Where in the human body can each occur and c) How do the cells produced compare in chromosome number to the parent cells?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro