Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

You are studying which of the multiple steps in gene

You are studying which of the multiple steps in gene expression you could tweak in order to produce a normal version of the huntingtin protein despite having the allele with the mutation. Which step in gene expression wo ...

John has difficulty swallowing loss of taste sensation in

John has difficulty swallowing, loss of taste sensation in the posterior one-third of the right half of his tongue, and decreased salivation, especially on the right side. Describe the sensory portion of the affected neu ...

Give four natural processes that result in dna transfer

Give four natural processes that result in DNA transfer between bacteria cells?

The mutation for huntingtons disease appears to have

The mutation for Huntington's disease appears to have originated in Western Europe, with a prevalence of 7 in 100,000 people. However, an isolated population in Lake Maracaibo in Venezuela, of European descent, have an i ...

Identify and give functions of the organs and structures of

Identify and give functions of the organs and structures of the urinary system.

What is the most common dna repair system in humans

What is the most common DNA repair system in humans, involving enzymatic functions and replacement of damaged DNA bases?

Part aprepare a powerpoint slides meeting below grading

PART A Prepare a powerpoint slides meeting below grading criteria covering topic Isoflavones and Polymethoxyflavones using recent original articles one from cell, frontier and nature. -recent articles related to the mech ...

First present the characteristics of water that make it

First present the characteristics of water that make it capable of hydrogen bonding. Then discuss why water is a good solvent and so readily exhibits capillarity. Finally, examine the heat properties of water, specifical ...

How when where and why might you apply your learning of

How, when, where and why might you apply your learning of bioethics in the future if you wanted to be a veterinarian?

How does presence of both high and low affinity operators

How does presence of both high and low affinity operators allow for coordination of DNA repair, recombination bypass, and translesion synthesis in response to varying levels of DNA damage?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen