Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

With which archaic human species did some of the ancestors

With which archaic human species did some of the ancestors of modern Europeans interbreed during the past 100,000 years?

State which cells in a human testis produce testosterone

State which cells in a human testis produce testosterone and its function(s) and state which hormones are produced by a human ovary, and their functions.

Identifynbspan organism that lives within 50 miles of your

Identify  an organism that lives within 50 miles of your home.  I live in Panama City, Florida 32405 I would like to use the wolf please? Write  a 1,050- to 1,400-word paper about how the organism has adapted to survive ...

Some bacteria utilize a protein molecule called

Some bacteria utilize a protein molecule, called bacteriorhodopsin, that uses light-activation to move protons across a membrane to generate a proton gradient that is then used by ATP-synthase to create energy for the ba ...

1 much pharmaceutical research targets developing

1. Much pharmaceutical research targets developing anti-cancer drugs that can effectively stimulate the methylation of DNA. Formulate a possible hypothesis to explain why DNA methylation might be an effective anticancer ...

Explain why the removal of great sharks poses a threat to

Explain why the removal of great sharks poses a threat to bay scallops on the Atlantic Coast of North America, despite the fact that large sharks do not feed on scallops. Include the concept of a trophic cascade in your ...

Focusing on thenbsprespiratory digestive urinary and

Focusing on the  respiratory, digestive, urinary, and reproductive systems.   Create a scenario  and give your patient a disease associated with any of these systems and present the history and symptoms of the particular ...

Imagine two parents are both heterozygous for two autosomal

Imagine two parents are both heterozygous for two autosomal genes. Assuming independent assortment, what proportion of their offspring are expected to have the same phenotype (for these two traits) as the parents? A) 0.2 ...

Comp 7 bio 40 project reliability of metagenomics

Comp 7/ Bio 40 Project: Reliability of Metagenomics Reads Background In this class, we are studying 16S rRNA metagenomic sequencing, in which the sequences read come from one of the hypervariable regions of the 16S rRNA ...

Due to the prospect of interplanetary travel how would you

Due to the prospect of interplanetary travel, how would you attempt to  Isolate  and  identify  a bacterial infection acquired on another planet. This bacteria is unknown to use and does not appear in  Bergey's  or the  ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen