Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

One important aspect of understanding health care in the us

One important aspect of understanding health care in the U.S. involves an analysis of the "Key Indexes of Health and Disease," as they are termed. Review the material on this topic in your textbook and other sources, and ...

For each of the following questions assume only one cycle

For each of the following questions, assume only one cycle of the TCA is completed during the course of the experiment. a) Oxaloacetate labeled at C4 with the radioactive isotope 14C is added to a suspension of respiring ...

Part anbspdefine each vocabulary word in the following

Part A  Define each vocabulary word in the following table. Use your textbooks or an outside source as references. Provide examples where requested, use complete sentences, and be clear and concise when explaining your a ...

Biologysickle cell disease1describe the disease and its

Biology Sickle Cell Disease 1. Describe the disease and its genetic basis. 2. Explain how this disease is inherited and why it is not always inherited. 3. Why is genetic testing controversial?

Discussion 1 and 2discussion 1- explain the difference

Discussion 1 and 2 Discussion 1- Explain the difference between the first and second line of body defenses against infection by pathogens Discussion 2- Identify the function(s) of the lymphatic system. Identify one diffe ...

Assignmentmutations occur when dna is not replicated

Assignment Mutations occur when DNA is not replicated properly. Fortunately, for the most part, cells have a mechanism to correct the mutation or destroy it. Sometimes that mechanism fails and the mutation survives. Spen ...

1 the results of the study of the occurrence of

1. The results of the study of the occurrence of tuberculosis (TB) in a village in Malawi are given in the table below. All individuals in the village were examined during two surveys made two years apart. Assume that th ...

Provide a 15 page single space in apa style reflection of

Provide a 1.5 page "single space" in APA style reflection of the video (Escape Fire The Fight to Rescue American Healthcare) https://www.youtube.com/watch?v=qkZlFMuVShE Respond to each of the following statements based o ...

Microscopy for microbiology - use and functionhands-on labs

Microscopy for Microbiology - Use and Function Hands-On Labs, Inc. Version 42-0249-00-02 Lab Report Assistant This document is not meant to be a substitute for a formal laboratory report. The Lab Report Assistant is simp ...

Biology1 a plant with red flowers is crossed with a

Biology 1. A plant with red flowers is crossed with a white-flowered plant of the same species. All the seeds, when grown, produce plants with red flowers. Assuming that the flower color is controlled by a single pair of ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate