Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

There is a common misconception that traditional taxonomy

There is a common misconception that traditional taxonomy is based on morphology, while cladistics is based on genetic data. How is this misconception incorrect?

Healthy people 2020 is a framework to assist communities in

Healthy People 2020 is a framework to assist communities in preventing disease and promoting health. Search the scientific literature and find a research study related to one of the focus areas identified by Healthy Peop ...

Provide answers to the following in essay forma identify

Provide answers to the following in essay form. a) Identify three different general types of fossil fuels. b) Identify and discuss environmental problems that are associated with using these fossil fuels. c) Identify 3 t ...

Can geneticists accurately predict the possibility of the

Can geneticists accurately predict the possibility of the inheritance of a genetic disease? Why or why not?

In beans yellow y is dominant to green y and smooth s is

In beans yellow (Y) is dominant to green (y) and smooth (S) is dominant to wrinkled (s). What are the possible genotypes for the offspring of the following cross: Yyss and Yyss.  YYss, yyss  YYSS, YYSs, YYss, YySS, YySs, ...

A bond with a par value of 1000 and a semi annual coupon

A bond with a par value of $1000 and a semi annual coupon has a nominal yield to maturity of 5.3% and a current price of $920. If the bond has 6 years to maturity, what is its current yield?

A man and a woman both have polydactyly ie six fingers on

A man and a woman both have polydactyly (i.e., six fingers on each hand), a trait which is determined in this example by a single gene. They have four children, none of whom have polydactyly. What is the probability thei ...

What releases prothrombin which helps in clotting of

What releases prothrombin which helps in clotting of blood?

Please describe four different categories of tissue

Please describe four different categories of tissue engineering strategies for repairing bone and cartilage injuries separately, and compare the advantages and disadvantages of these strategies?

Weve all had experiences where we have been frustrated by a

We've all had experiences where we have been frustrated by a decision that our supervisor made. You have probably blamed this decision on your boss being "closed-minded," "stubborn," or "pigheaded." But after reading the ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro