Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

The lac operator binds the lac repressor the dna sequence

The lac operator binds the lac repressor. The DNA sequence of the lac operator shares a characteristic with the DNA sequences of the binding sites of many restriction enzymes. What is this common characteristic?

A multicellular lifeform has a weird type of cell in its

A multicellular lifeform has a weird type of cell in its body. This cell has a high density of peroxisomes. What is the most reasonable function of this cell? Functions for redox reactions Functions for digestion Functio ...

Anthropology la zoo paperzoo projectintroduction this

Anthropology La zoo paper Zoo project INTRODUCTION: This assignment is designed to help you learn more about and observe in real time some of the primates we have studied in our course, in this case the chimpanzee. Besid ...

How might 32p and 35s be used to demonstrate that the

How might 32P and 35S be used to demonstrate that the transforming principle is DNA? Briefly outline an experiment that would show that DNA rather than protein is the transforming principle.

Explain why the removal of great sharks poses a threat to

Explain why the removal of great sharks poses a threat to bay scallops on the Atlantic Coast of North America, despite the fact that large sharks do not feed on scallops. Include the concept of a trophic cascade in your ...

Which cultures would be more likely to focus on external

Which cultures would be more likely to focus on external controls? Which cultures would consider direct controls to be more important than indirect controls? Be specific and explain your answer.

In the united states in 2006 the total population was

In the United States in 2006, the total population was approximately 298,363,000. Of these, fires killed approximately 3,100 people. For a person in the United States in 2006, what was the risk of being killed by a fire? ...

A man and a woman both have polydactyly ie six fingers on

A man and a woman both have polydactyly (i.e., six fingers on each hand), a trait which is determined in this example by a single gene. They have four children, none of whom have polydactyly. What is the probability thei ...

Color vision gave our primate ancestors great advantages if

Color vision gave our primate ancestors great advantages. If color vision is an advantage, discuss how the condition of color-blindness still exists in humans today.

Out of proteins lipids and carbohydrates present in a cell

Out of proteins, lipids and carbohydrates present in a cell membrane, which of the three is minimum?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen