Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA

(a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

(b) Determine the sequence of amino acids coded for by this mRNA.

(c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an ex describe how is this possible.

(d) When DNA is replicated, errors in copying may occur, leading to the substitution of one base for another in the DNA sequence. Given two reasons why these errors often have little or no effect on the polypeptide produced in the transcription and translation of that particular DNA sequence.

(e) The deletion or insertion of a single base into a DNA sequence can seriously affect the functionality of the polypeptide that the DNA codes for. What would be the effect on the final polypeptide produced if the DNA sequence you wrote down in part (a) was changed in the following ways?

i) Insertion of the base T at the beginning of the DNA sequence.
ii) Deletion of the 10th base in the DNA sequence.

In each case prepare down the new DNA sequence followed by the new mRNA sequence corresponding with this altered DNA.

describe the possible effect on the polypeptide produced.

(f) Referring to the mRNA sequence taken from the bacteria, it is possible to deduce the exact corresponding DNA sequence of a specific gene. In eukaryotic organisms the relationship between the number of sequence of bases in the mRNA and in the corresponding DNA is not so straightforward. describe why it is not possible to predict the exact sequence of bases in eukaryotic DNA by examining the corresponding mRNA alone.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M927966

Have any Question? 


Related Questions in Biology

How many neutrons does element x have if its atomic number

How many neutrons does element x have if it's atomic number is 42 and it's mass number is 154?

Some boxers and wrestlers dehydrate abruptly by spending

Some boxers and wrestlers dehydrate abruptly by spending time in a sauna and sweating a lot in order to lose weight and compete with a lower tier, however this is a serious health hazard, explain what happens to the toni ...

Digestion is an important process in the human bodya

Digestion is an important process in the human body. a) Identify and describe the digestive processes. b) Consider the mouth, stomach, small intestines and large intestines - identify the digestive enzymes that are prese ...

Discussion topicolder people die for a number of reasons

Discussion Topic Older people die for a number of reasons: cancer, heart failure, complications due to diabetes, stroke, Alzheimer's, etc. Often times, the way we live our lives affect not only how long we live but what ...

What did the experiments by stanley miller demonstrate

What did the experiments by Stanley Miller demonstrate about the formation of the first organic molecules? Why was it significant?

List and describe different sediments that can be seen in

List and describe different sediments that can be seen in urine and differentiate between normal and abnormal sediments.

The effect of low ph on enzyme activitydesign an experiment

The Effect of low pH on Enzyme Activity Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. (Recall: enzymes are proteins.) To complete this project, it may be useful for you ...

There is a common misconception that traditional taxonomy

There is a common misconception that traditional taxonomy is based on morphology, while cladistics is based on genetic data. How is this misconception incorrect?

Hans had had a strep throat two weeks before he was to

Hans had had a strep throat two weeks before he was to start anew job. He had to complete some work before he could resign fromhis old position so he ignored the bacterial infection. In thefirst week of his new job he no ...

In an experimental template having perfectly placed 5

In an experimental template having perfectly placed 5 nucleosomes there is a single EcoR1 site buried near dyad axis of the 3rd nucleosome. Is it possible for a modeller to make this site accessible without disturbing an ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen