Find the sequence of amino acids coded for by this, Ask an Expert

Academics

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene.

AUGUUUGCUGGGGGACAUUCGUGGGCA
from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed.

Determine the sequence of amino acids coded for by this mRNA

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M9215517

Have any Question?Write your Review or question?

Related Questions in Biology

Igfbp2 rbp4 and factor d post bariatric surgeryigfbp2 what

IGFBP2/ RBP4 and Factor D Post Bariatric Surgery IGFBP2 ( what the normal physiological action in the body? And how it affectedby obesity? andpost bariatric surgery?) RBP4 (what the normal physiological action in the bod ...

If someone has been sitting without standing for 6 hours

If someone has been sitting without standing for 6 hours, and blood has been pooling in their veins, why would they feel dizzy when they stood up? How does this related to stroke volume and mean arterial pressure?

Why were there no large mammals around when the dinosaurs

Why were there no large mammals around when the dinosaurs occupied the land?

What is the complementary strand for 5-atgcatgcatgccc-3how

What is the complementary strand for: 5'-ATGCATGCATGCCC-3' How many turn(s) will this strand have? Are Eukaryotic cells always diploid during S phase whereas bacteria are only haploid at the end of DNA replication?

Chosen dr jan nolta- stem cell researcher head of uc davis

Chosen Dr. Jan Nolta- Stem Cell Researcher Head of UC Davis Stem Cell Program Director Topic Background: early Stem cells have the ability to develop into many different types of cells. Stem Cell Research is not without ...

A patient had abnormally low ch50 results ie abnormally low

A patient had abnormally low CH50 results (i.e., abnormally low lysis of antibody coated sheep red blood cells) would abnormally low levels of Bb explain the CH50 assay results? Why or Why not?

You have been allocated a cdna accession number from the

You have been allocated a cDNA accession number from the NCB' database (see table below on page 2). Your task is to design experimental strategies that will allow you to: clone the cDNA in different expression vectors us ...

Assignment 1 create at least a 350-word blog post in

Assignment 1: Create at least a 350-word blog post in Microsoft® Word in response to the following question: Female copperhead snakes have the ability to reproduce both sexually and asexually. In your opinion, which meth ...

Assignment on nutrition - q1 task you need to select 2

Assignment on Nutrition - Q1. Task: You need to select 2 different age groups of your choice. You will need to plan balanced meals with snacks for a day. Once you have laid out the meal plan you need to: Explain why the ...

If the atomic number of an element is 12 and the atomic

If the atomic number of an element is 12 and the atomic mass is 25. How many protons are there in the nucleus? How many neutrons are there in the nucleus? How many electrons are in the atom?

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert