Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

Topic genomicsquestion describe how the use of genetic

Topic: Genomics Question: Describe how the use of genetic knowledge can change the course of disease. What are the implications of the prolific use of genetic knowledge for the intervention of disease? Should there be an ...

Freckles f and six fingers s are dominant alleles in humans

Freckles (F) and six fingers (S) are dominant alleles in humans and the genes occur on different chromosomes. If an FfSs male and an FfSs female have a WHOLE BUNCH of kids, Here are the expected ratios below. 9: freckles ...

Reproductive systemdefine primary sex organs secondary sex

Reproductive System Define primary sex organs, secondary sex organs, and secondary sex characteristics Describe the accessory glands and other secondary sex organs of the male/female, and state their functions Explain th ...

Imagine you do a test cross between a purple-flowered pea

Imagine you do a test cross between a purple-flowered pea plant having serrated leaves (a dominant trait) and a white-flowered pea plant having smooth edges. If the purple-flowered plant is heterozygous for both traits, ...

For this assignment you will think about your individual

For this Assignment you will think about your individual health and health risks. What genetic diseases or problems might you face during your lifetime? Predisposition to heart disease, breast cancer, diabetes? You may c ...

Looking for assistance with the below information regarding

Looking for assistance with the below information regarding alternatives to landfills. References are needed. Alternatives to Landfills The use of sanitary landfills for burial of municipal solid wastes has been the prim ...

For training and development classcompare and contrast two

(For Training and Development Class) Compare and contrast two learning theories. Which one do you believe is most effective? Why? Your response should be at least 200 words in length.

Answer the following questionwhat is the domain and kingdom

Answer the following question: What is the domain and kingdom for an organism that has a nucleus, is not motile, and does not perform photosynthesis? What is taxonomy? What role does this serve? How does taxonomy assist ...

Freckles f and six fingers s are dominant alleles in humans

Freckles (F) and six fingers (S) are dominant alleles in humans and the genes occur on different chromosomes. If an FfSs male and an FfSs female have a WHOLE BUNCH of kids, Here are the expected ratios below. 9: freckles ...

Consider the food web for lake erie shown abovegive a

Consider the food web for Lake Erie shown above. Give a detailed analysis of this food web. Be sure to address the following in your analysis:  A description of the producers and consumers (you do not need to list every ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro