Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

1 how does the structure of dna double helix determine how

1. How does the structure of DNA (double helix) determine how the genetic information is passed on? 2. How does the cell use the information contained in the DNA to construct proteins (transcription and translation)?

A man and wife have a daughter she marries and has a son

A man and wife have a daughter. She marries and has a son who is colorblind, a sex-linked trait. She has normal vision. Using the letters "C" and "c", list all potential genotypes for the man and his wife. What is the pr ...

Research and briefly describe a real world example about

Research and briefly describe a real world example about acid rain affects plants. Be sure to demonstrate how pH contributes to the outcome, and proposed solutions. Descriptions should be approximately 2-3 paragraphs. In ...

Assume the role of a research scientist who is applying for

Assume the role of a research scientist who is applying for grant money to fund research on ALS. Describe the particular area of research that you would investigate (drug-based therapies that would slow the progression o ...

Focus on case studies in neurologyfor this assignment you

Focus on Case Studies in Neurology For this assignment you will respond to three case studies. What is a Case Study? "A case study is a narrative used to help you practice real-life analysis and communication skills. It ...

What do we call the transfer of pollen grains from anther

What do we call the transfer of pollen grains from anther to the stigma in plants?

Digestion is an important process in the human bodya

Digestion is an important process in the human body. a) Identify and describe the digestive processes. b) Consider the mouth, stomach, small intestines and large intestines - identify the digestive enzymes that are prese ...

Contrast the different types of stem cells including pros

Contrast the different types of stem cells, including pros and cons of each.

What regulatory proteins in prokaryotic gene regulation

What regulatory proteins in Prokaryotic gene regulation share the common characteristic of forming DNA loops when they are functioning? Be specific

Are there some bacteria that are not easily stained by the

Are there some bacteria that are not easily stained by the gram stain? Can you give an example of a bacterium that might not show up as gram-positive or gram-negative after being stained by Gram's method?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro