Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

Jerry coyne proposes a question at what point are the

Jerry Coyne proposes a question. At what point are the differences between populations large enough to make us call them different species? please answer question and defend answer.

Bacterial srnas activate and repress translation by

Bacterial sRNA's activate and repress translation by exposing or covering RBS (ribosome binding site) on mRNA. Riboswitches also activate and repress translation by exposing or covering RBS on mRNA. How do these two regu ...

Trace the path of a sperm out of the male body and the path

Trace the path of a sperm out of the male body and the path of a sperm into the female body to an oocyte.

How to apply kantian and utilitarian theories to the

How to apply Kantian and Utilitarian theories to the situation that existed at Memorial Medical Center in the days immediately after Hurricane Katrina, was Dr. Anna Pou's treatment of the LifeCare patients on the seventh ...

Select at least 2 cell structures what hypothesis could you

Select at least 2 cell structures. What hypothesis could you form to explain what would happen to the cell or the organism if each cell structure were damaged or destroyed?

Annotated bibliographypick a type of cancer to research

Annotated Bibliography Pick a type of cancer to research. Find articles that answer questions concerning your chosen type of cancer. This assignment will help you to organize the sources you will use in the Unit V Resear ...

You believe that the cytosolic protein p007 is involved in

You believe that the cytosolic protein p007 is involved in mediating growth hormone-stimulated proliferation in cells. You wish to establish a cell model using your cultured fibroblasts. Provide clear explanations to the ...

Lets say that robert baratheon despite being king was

Let's say that Robert Baratheon, despite being king, was unlucky enough to be heterozygous from Huntington's disease and heterozygous polycystic kidney disease-2 (caused by a mutation in the Polycystin-2 gene). However, ...

What are the characteristics of tropical waters temperate

What are the characteristics of tropical waters, temperate waters and polar waters?

Microbiology1 for what specific purpose was gram staining

Microbiology 1. For what specific purpose was gram staining developed for? what is it used for today? 2. Why is the presence of air bubbles a sign of contamination? 3. Why is a gram stain helpful when monitoring bacteria ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro