Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

Assignmentanatomy amp physiologydirections be sure to save

ASSIGNMENT Anatomy & Physiology Directions: Be sure to save an electronic copy of your answer before submitting it to Ashworth College for grading. Unless otherwise stated, answer in complete sentences, and be sure to us ...

Assignmentappendix c organizational requirements for

Assignment Appendix C: Organizational Requirements for Phototropism Virtual Laboratory Paper Introduction: Provide readers with the experiment's background information, and present the hypothesis in approximately 175 wor ...

Organic chemistry1 there is an attachement with 24

Organic Chemistry 1. There is an attachement with 24 molecules. Make three classification based on the function group. 2. Fill out the chart in the attactment. Complete the flowchart for the separation and isolation of: ...

Biology class must cite work must be 250 wordsyoutube url

Biology class. Must cite work, must be 250 words. YouTube URL: http://www.youtube.com/watch?v=rjza24Oyalc Dieters often talk about their metabolism. What is metabolism? Catabolism? Anabolism? Total metabolic rate (TMR)? ...

Biology assignmentwatch this video Biology Assignment Watch this video first

Biology Assignment Watch this video first https://www.youtube.com/watch?v=aaNnGs7MmUY Part II. Fill-in You are now studying the process of mitosis in the simple organism, R. catus, andhave prepared microscope slides of f ...

For the optimal temperature experiment which

For the optimal temperature experiment, which enzyme/substrate pair did you use? List your results for the absorbance at one minute when the temperature was 10, 20, 30, 40, 50, 60, 70 and 80 degrees. Based on your result ...

Trypanosoma brucei is the agent that causes african

Trypanosoma brucei is the agent that causes African sleeping sickness in humans bitten by the tsetse fly. Glycolysis is unusual in this organism, providing an opportunity to create drugs that poison the parasite without ...

Write the null and research hypotheses for the following

Write the null and research hypotheses for the following description of a research study: A group of middle-aged men was asked to complete a questionnaire on their attitudes toward work and family. Each of these men is m ...

In the following experiment students plated e coli top

In the following experiment, students plated E. coli (top right), S. epidermidis (top left), P. Aeruginosa (bottom right) and E. aerogenes (bottom left) on Trypticase soy agar (Yellow media), Glucose mineral salts agar ( ...

1what are the components of the cardiovascular system list

1. What are the components of the cardiovascular system? List them. 2. List two functions of the cardiovascular system. 3. Fill in the blank. Blood never leaves the blood vessels and does not exchange substances directly ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate