Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

Please help me with these questions1 describe how sex is

Please Help me with these questions: 1. Describe how sex is determined in humans 2. Describe what sex linkage is and give an example 3. Define dosage compensation. 4. Define nondisjunction and describe a scenario in whic ...

Need a paper 0 of plagiarismreferences included 6-7 pages

Need a paper, 0% of plagiarism.references included. 6-7 pages single-spaced Topic is a brand "Chanel" 1. Evaluate the product, pricing, and channel strategies (Chapter 5). 2. Explain how the brand personalizes its market ...

1 give one hypothesis about the relationship between

1) Give one hypothesis about the relationship between protein sequence and protein color that you tested in the Aipotu I: Genetics & Biochemistry lab. 2) Give the genotype of each of the four starting strains of Aipotian ...

What type of classes of infections may yeast and molds

What type of classes of infections may yeast and molds cause?

Why is thermoregulation so important based on the q10nbspof

Why is thermoregulation so important based on the Q 10  of a physiological process?

List the following in order from smallest to largest

List the following in order from smallest to largest: (Chromosome, DNA, Chromatin, Chromatid, Gene, Nucleotide)

What policies at the local state or federal level eg

What policies at the local, state or federal level (e.g., education, transportation, employment, etc.) might reduce social and economic inequities? (b) What would a more equitable society look like? (c) Who can make it h ...

If you set up a transformation experiment in which you

If you set up a transformation experiment in which you mixed competent E. Coli with a new plasmid that carried a gene for GFP, but not a gene for ampicillin-resistance, what colonies would you expect to grow on an LB pla ...

Explain how stems cells are can be used to treat diseases

Explain how stems cells are can be used to treat diseases and injury, with special focus on spinal cord injuries.

Terminology cell division andgeneticswrite short

Terminology Cell Division andGenetics Write short definitions for each ( 1 or 2 sentences ) Sexual reproduction- Asexual reproduction- Centromere- Metacentric- Submetacentric- Telocentric- Chromatids- Karyotype- Centriol ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro