Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

If you set up a transformation experiment in which you

If you set up a transformation experiment in which you mixed competent E. Coli with a new plasmid that carried a gene for GFP, but not a gene for ampicillin-resistance, what colonies would you expect to grow on an LB pla ...

Clearly explain why health outcome is so much more than a

Clearly explain why health outcome is so much more than a combination of health care, individual behaviors, and/or genetics?

Blame for commercial overexploitation can be placed on the

Blame for commercial overexploitation can be placed on the people who directly do the exploiting and those that buy the product - but which group deserves more of the the blame? Why? What is an example of a commercial re ...

Concerning a patient with autonomic dysreflexiawith what

Concerning a patient with autonomic dysreflexia: With what you know of the etiology for the hypertension, was labetalol a good choice for managing the blood pressure? Why or why not? If not, what other kind of drug do yo ...

Looking for assistance with the below information regarding

Looking for assistance with the below information regarding alternatives to landfills.  References are needed. Alternatives to Landfills The use of sanitary landfills for burial of municipal solid wastes has been the pri ...

During the separation of the different photosynthetic

During the separation of the different photosynthetic pigments of spinach by paper chromatography, how did you know which of the pigments was the least polar? It travelled the farthest on the paper (was the first pigment ...

3 to 4 line sentences for responserecent estimates suggest

3 to 4 Line sentences for response: Recent estimates suggest that 70% of processed food in the US contains genetically modified ingredients, largely from genetically modified soy beans. Unlike many other countries, the U ...

We all see animals in our day to day lives choose a

We all see animals in our day to day lives. Choose a behavior you saw exhibited by an animal. Explain your thoughts on the potential proximate and ultimate causes of the behavior.

1 how is gene expression regulated give three different

1. How is gene expression regulated (give three different forms of regulation mechanisms)? 2. How does gene regulation relate to cancer development?

Do you think there are political issues surrounding human

Do you think there are political issues surrounding human population growth? Why or why not? Can you give an example?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro