Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

The end products of both mitosis and meiosis is a set of

The end products of both mitosis and meiosis is a set of chromosomes. Explain the differences between the two sets. Suppose that Mendel had decided to use dogs for his experiments. What problems would he have had that he ...

What is the specialised cell that is responsible for

What is the specialised cell that is responsible for production?

Anthropology la zoo paperzoo projectintroduction this

Anthropology La zoo paper Zoo project INTRODUCTION: This assignment is designed to help you learn more about and observe in real time some of the primates we have studied in our course, in this case the chimpanzee. Besid ...

Describe how the central nervous system is protected from

Describe how the central nervous system is protected from injury. List the components of a spinal reflex arc. Describe the function of each component.

There is a common misconception that traditional taxonomy

There is a common misconception that traditional taxonomy is based on morphology, while cladistics is based on genetic data. How is this misconception incorrect?

List and describe different sediments that can be seen in

List and describe different sediments that can be seen in urine and differentiate between normal and abnormal sediments.

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

Genes a b and c assort independently if a plant with the

Genes A, B, and C assort independently. If a plant with the genotype AabbCc is crossed to another plant with the genotype AABbCc, what proportion of the progeny will be AabbCC?

With which archaic human species did some of the ancestors

With which archaic human species did some of the ancestors of modern Europeans interbreed during the past 100,000 years?

How many kidneys does a human being has when he is

How many kidneys does a human being has when he is born?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen