Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

1 what are the benefits of sequencing the genome of an

1) What are the benefits of sequencing the genome of an organism? Explain by giving 3 examplesfor the applications of genomic information. 2) Why do not modern apes become human today? World limit is between 250-400

What is the process of dna replication please include

What is the process of DNA replication? Please include descriptions and possibly diagrams to further explain the process.

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

Select one chronic illness that could be diagnosed early in

Select one chronic illness that could be diagnosed early in life, such as asthma, diabetes, or rheumatoid arthritis. Follow a person with this chronic illness through the lifespan, discussing how treatment approaches wou ...

Describe how the central nervous system is protected from

Describe how the central nervous system is protected from injury. List the components of a spinal reflex arc. Describe the function of each component.

When we activate multiple motor units their individual

When we activate multiple motor units their individual force combine to produce a greater force through what?

1 uterine contractions that are irregular and brief that

1) Uterine contractions that are irregular and brief that occur toward the end of gestation are called ________. 2) The hollow cavity within the blastocyst is the ________. 3) The process by which a viable embryo is form ...

Please solve the problems with correct answers instead of

PLEASE SOLVE THE PROBLEMS WITH "correct" answers, instead of just writing answers. THANKS! (1) Halophytes are plants that live in moist soils with high salt concentrations. Despite being surrounded my water, halophytes a ...

What did the experiments by stanley miller demonstrate

What did the experiments by Stanley Miller demonstrate about the formation of the first organic molecules? Why was it significant?

Which genetic material was discovered by robert brown and

Which genetic material was discovered by Robert Brown and in which year.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen