Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

Assignment1 what do pollen dust mites certain foods and

Assignment 1) What do pollen, dust mites, certain foods and drugs, insect venom, fungal spores, and some ingredients in cosmetics have in common? they often contain dangerous bacteria they often act as allergens they all ...

Two immune system questionsactivated t-helper cells aid in

Two immune system questions: Activated T-helper cells aid in humoral immune responses by releasing cytokines which promote antibody production, phagocytosis, neutralization and apoptosis. Which parts of this statement ar ...

1 what cultural considerations does a medical assistant

1. What cultural considerations does a medical assistant need to be aware of when addressing issues related to the female reproductive system? 2. Taking a patient's reproductive health history requires that the medical a ...

Immune and musculoskeletal diseasesresearch an autoimmune

Immune and Musculoskeletal Diseases Research an autoimmune disease that affects the musculoskeletal system.  Write a 2-page paper. Address the following in the paper: The pertinent information on both the immune and musc ...

1which group of algae appears to be the most closely

1. Which group of algae appears to be the most closely related to the ancestors of true plants? Name one feature that appears to be homologous. 2. What are microphylls and which group of seedless vascular plants are they ...

Differentiate between ectoderm mesoderm and endoderm and

Differentiate between ectoderm, mesoderm and endoderm and list what tissues arise from each.

The lac operator binds the lac repressor the dna sequence

The lac operator binds the lac repressor. The DNA sequence of the lac operator shares a characteristic with the DNA sequences of the binding sites of many restriction enzymes. What is this common characteristic?

Hypophosphatemia is a dominant genetic disorder caused by a

Hypophosphatemia is a dominant genetic disorder caused by a deficiency of phosphates in the blood. Asssuming the other parent is free of the disorder, males with the disorder will pass it on to their daughters but not th ...

Hey you answered my question about gastrulation and there

Hey you answered my question about Gastrulation and there were 2 different answers I received. Are you sure gastrulation produces pluripotent stem cells?

What is produced by inflation of the apex of the

What is produced by inflation of the apex of the conidospore and later the inflated apex is separated by a septum?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen