Use the genetic code table in your textbook to aid you in answering the problems below.
a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'
b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.
c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?