Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

Discuss the mechanisms by which the lactoselac operon

Discuss the mechanisms by which the lactose(lac) operon functions in medium with an excess of lactose and a medium with lactose excess and glucose. Give 10 points

What does precautionary principle mean how would you apply

What does precautionary Principle mean. How would you apply the concept of the Precautionary Principle to the unrestricted allowance of endocrine disrupters in consumer products?

1 what cultural considerations does a medical assistant

1. What cultural considerations does a medical assistant need to be aware of when addressing issues related to the female reproductive system? 2. Taking a patient's reproductive health history requires that the medical a ...

Discuss the concept of risk and diversification and

Discuss the concept of risk and diversification and highlight types of risk correlation within portfolio with more than one asset?

Climate of Climate of Doubt:  www.pbs.org/wgbh/frontline/film/climate-of-doubt/ this

Climate of Doubt:  www.pbs.org/wgbh/frontline/film/climate-of-doubt/ this video is about 1 hour watch.  Anyone who answer this question skill this video up to 25min then watch the rest. 1. Who is Bob Inglis and what happ ...

Anakin with a genotype of ao rhd- has fraternal twins luke

Anakin with a genotype of A/O RhD+/- has fraternal twins (Luke and Leia) with Padme, whose genotype is A/O RhD-/-. Luke and his uncle Owen have never had their blood type tested. Leia has her blood typed and it is A RhD+ ...

1 the ductus arteriosus and the ductus venosus are two key

1) The ductus arteriosus and the ductus venosus are two key vessels in the fetal circulation that are absent in the adult circulation. What are their function in the fetus? Why are they necessary? 2) At birth, the fetal ...

Please follow the rubric with the name tina jones

Please follow the rubric with the name tina jones 28-year-old female admitted to shadow general hospital for a right infected foot after cutting it on a ladder falling off a stepstool, turned into cellulitis. Treated in ...

1 what are the benefits of sequencing the genome of an

1) What are the benefits of sequencing the genome of an organism? Explain by giving 3 examplesfor the applications of genomic information. 2) Why do not modern apes become human today? World limit is between 250-400

How when where and why might you apply your learning of

How, when, where and why might you apply your learning of bioethics in the future if you wanted to be a veterinarian?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen