Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

Use the genetic code table in your textbook to aid you in answering the problems below.

a. Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5'AUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3'

b. describe how the above sequence in "a" illustrates that redundancy of the genetic code.

c. describe what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

Biology, Academics

  • Category:- Biology
  • Reference No.:- M944250

Have any Question? 


Related Questions in Biology

A foreign america executive finds that a foreign subsidiary

A foreign America executive finds that a foreign subsidiary in a poor nation has hired a 12-year-old girl to work on a factory floor, In violation of the company's prohibition on child labor. He tells the local manager t ...

Using globe study results and other supporting data

Using GLOBE study results and other supporting data, determine what Japanese managers believe about their subordinates. How are these beliefs similar to those of the U.S. and European Managers? How are these beliefs diff ...

Identifynbspan organism that lives within 50 miles of your

Identify  an organism that lives within 50 miles of your home.  I live in Panama City, Florida 32405 I would like to use the wolf please? Write  a 1,050- to 1,400-word paper about how the organism has adapted to survive ...

What alternative forms of energy should we be using in

What alternative form(s) of energy should we be using in Florida and why?

Discussion topicolder people die for a number of reasons

Discussion Topic Older people die for a number of reasons: cancer, heart failure, complications due to diabetes, stroke, Alzheimer's, etc. Often times, the way we live our lives affect not only how long we live but what ...

In this assignment you will select a fermented food or

In this assignment, you will select a fermented food or beverage from the list provided. After making your selection, you will prepare a 3 page written report about it. The report should include historical information re ...

Prevention of disease through vaccinationchoose a

Prevention of Disease through Vaccination Choose a diseases/disorder that you learned about this week that can be prevented through vaccination.  Research the disease background including etiology, symptoms, treatment, a ...

Over half of the bodys glucose is metabolized in the brain

Over half of the body's glucose is metabolized in the brain. Very few of the alternate fuels are used in the brain, but are commonly used by other parts of the body. Muscles increase their use of glucose with increasing ...

1 explain how insulin regulates glucose levels in the

1. Explain how insulin regulates glucose levels in the blood? 2. What is unique about the glands of the endocrine system?

Two adjacent filaments of spirogyra affins each 10 cells

Two adjacent filaments of spirogyra affins each 10 cells participating in reproduction. How many new Spirogyra plants are produced during sexual reproduction?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen