Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Biology Expert

Essay Assignment

Part A. Answer all question

A result of recent developments in fuel cell technology, serious consideration is given to direct alcohol fuel cells in which alcohol is used directly as the fuel. Methanol and ethanol are the most promising fuels for transportation applications. To assess the environmental benefits of these fuel choices over petroleum, it is important to analyze their energy uses and emissions during the fuel cycle. Evaluation of greenhouse gas emission is being taken in to consideration in order to evaluate the efficiency of each type of fuel cells. In this experiment only, CO2 was used as a variable. Amount of CO2 in grams per kilometer of driving is used as a unit of measurement.

Type of fuel cell

Amount of CO2 (g/Km)Trial 1

Trial 2

Trial 3

Ethanol

200

185

253

Methanol

180

155

172

Petroleum

250

379

227

Make a bar graph with the information given above and take a conclusion from your data.

Answer only four questions.

01. Compare and contrast all three categories of carbohydrates.

02. Red(R) color is dominant over white color (r) flower petals. Long petal (L) is dominant over short petals. Traits color and length are located on chromosome number 4 and 5 respectively. What are the probability of all genotype and phenotypes of the F1 generation when two heterozygote flowers are crossed.

03. Draw a plant cell and state the function of each organelle.

04. Explain the Miller-Urey experiment and its' significance

05. What is the primary amino acid sequence of the following DNA sequence

DNA- "AGCATGTTACCCATTGATGGGGGATAA"

Biology, Academics

  • Category:- Biology
  • Reference No.:- M92587334
  • Price:- $35

Priced at Now at $35, Verified Solution

Have any Question?


Related Questions in Biology

A patient had abnormally low ch50 results ie abnormally low

A patient had abnormally low CH50 results (i.e., abnormally low lysis of antibody coated sheep red blood cells) would abnormally low levels of Bb explain the CH50 assay results? Why or Why not?

If you diluted 1 ml of a sample into 9 ml of water then

If you diluted 1 ml of a sample into 9 ml of water, then took 1 ml of that and diluted into another 9 ml of water, and did that another two times, what is fold the dilution factor?

1 identify the maternal homolog for both chromosome 1 and 2

1.) Identify the maternal "homolog" for both Chromosome 1 and 2 and then the paternal homologs. Arrange these chromosomes as you would expect to find them during  G 1  of  interphase. What is the haploid number of our ce ...

Question choose one of the following topics and write a

Question: Choose one of the following topics and write a 400-500 word essay. You must cite at least 2 primary sources. Follow the proper citation format for articles and or websites. You must use direct (primary) sources ...

What types of molecular interactions occur between the

What types of molecular interactions occur between the active site and the substrate?

Question - a pure strain of mendels peas dominant for all

Question - A pure strain of mendel's peas, dominant for all seven of his independently assorting genes, was testcrossed. How many different kinds of gametes could the F1 PRODUCE?

What problems does this traditional classification scheme

What problems does this traditional classification scheme of protists create in our understanding of the evolutionary relationships that exist between protists?

A suspension is formed from uniform particles of solid of

A suspension is formed from uniform particles of solid, of diameter 10 Mm, suspended in a solvent. What is the best description of this system?

Write the null hypothesis for the effect of temperature on

Write the null hypothesis for the effect of temperature on catechol oxidase activity?

A man and woman both with normal vision have 1 a

A man and woman, both with normal vision, have (1) a color-blind son who has a daughter of normal vision; (2) a daughter of normal vision who has one color-blind son and one normal vision son, and (3) another daughter of ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As