Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

Which component of a muscle does the ca combine with to

Which component of a muscle does the Ca^++ combine with to allow a contraction to occur? When a muscle is simulated before the muscle can fully relax, it can cause muscle twitch tetarus muscle tendritis When a muscle is ...

Bacterial cells have only one dna molecule which is double

Bacterial cells have only one DNA molecule, which is double stranded and is replicated in essentially the same fashion as in eukaryotes. Imagine that, following the techniques of other scientists studying DNA, you create ...

Research paperguidelines for your research paper comparison

Research Paper Guidelines for Your Research Paper (Comparison / Contrast) 1. Title Page (begin on page1) 3 points A. Title is followed by Author's Name at the Top Portion. B. Is your title specific and informative? C. Do ...

Write an essay on the differences and similarities of

Write an essay on the differences and similarities of creation science and intelligent design creationism, and how do they stand up as actual science?

What is the probability of a cross resulting in white

What is the probability of a cross resulting in white offspring when two heterozygous purple pea plants (e.g. Pp x Pp) are bred? What is the genotype for this offspring?

Eplain how microevolution can lead to macroevolution

Explain how microevolution can lead to macroevolution. Provide a hypothetical example to illustrate your explanation.

Healthy people 2020 is a framework to assist communities in

Healthy People 2020 is a framework to assist communities in preventing disease and promoting health. Search the scientific literature and find a research study related to one of the focus areas identified by Healthy Peop ...

Describe and give examples of the primary human tissues and

Describe and give examples of the primary human tissues, and where in the body each can be found. Please include references.

Freckles f and six fingers s are dominant alleles in humans

Freckles (F) and six fingers (S) are dominant alleles in humans and the genes occur on different chromosomes. If an FfSs male and an FfSs female have a WHOLE BUNCH of kids, Here are the expected ratios below. 9: freckles ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro