Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Caleb has a lung infection caused by the bacterium

Caleb has a lung infection caused by the bacterium Streptococcus pneumoniae, an extracellular pathogen. What type of adaptive immune response (humoral or cell mediated) will Caleb's immune system have to the bacteria? Su ...

Discuss the mechanisms by which the lactoselac operon

Discuss the mechanisms by which the lactose(lac) operon functions in medium with an excess of lactose and a medium with lactose excess and glucose. Give 10 points

Jillian is thrown from a horse she strikes the ground with

Jillian is thrown from a horse. She strikes the ground with her chin, causing severehyperextensionof the neck. Emergency medical technicians properly immobilize her neck and transport her to a hospital, but she dies 5 mi ...

The sheep dolly was the first animal cloned by

The sheep Dolly was the first animal cloned by transplanting the nucleus from a cell from an adult sheep into an egg of a donor sheep. Dolly appeared to grow normally for several years, but at age 6, she developed compli ...

Describe the purpose of the human genome project and how it

Describe the purpose of the Human Genome project and how it was achieved. Form a hypothesis of future research that could benefit from the HGP.

1 the ductus arteriosus and the ductus venosus are two key

1) The ductus arteriosus and the ductus venosus are two key vessels in the fetal circulation that are absent in the adult circulation. What are their function in the fetus? Why are they necessary? 2) At birth, the fetal ...

In anotherchapter you will learn of evidence that primates

In anotherchapter, you will learn of evidence that primates, especially fossil species in the Hominin group that apparently led to our currentHomo sapiens sapiensspecies identity. Many of the fossils of pre-human species ...

What is one example of an organism that belongs to

What is one example of an organism that belongs to platyhelminthes?

Differentiate between ectoderm mesoderm and endoderm and

Differentiate between ectoderm, mesoderm and endoderm and list what tissues arise from each.

Scientific advances are pointing researchers to new ideas

Scientific advances are pointing researchers to new ideas about how to reduce the side effects of epilepsy medications and improve therapy options for those resistant to current medications. Ongoing studies in animals an ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro