Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Formatnbsp at least one page in length 1-inch margins size

Format:   At least one page in length, 1-inch margins, size 11 font, double spaced.  Sources:   All sources must be properly cited within  and  at end of paper. Use MLA or APA style. Please do the following: Go to the in ...

1 the ductus arteriosus and the ductus venosus are two key

1) The ductus arteriosus and the ductus venosus are two key vessels in the fetal circulation that are absent in the adult circulation. What are their function in the fetus? Why are they necessary? 2) At birth, the fetal ...

Topic 1 discussion topiclist four areas of negligence for

Topic 1: Discussion topic List four areas of negligence for allied health professionals. Discuss the standard of care in each area, and how that standard can be applied to the healthcare facility.

Looking for assistance with the below information regarding

Looking for assistance with the below information regarding alternatives to landfills.  References are needed. Alternatives to Landfills The use of sanitary landfills for burial of municipal solid wastes has been the pri ...

The end products of both mitosis and meiosis is a set of

The end products of both mitosis and meiosis is a set of chromosomes. Explain the differences between the two sets. Suppose that Mendel had decided to use dogs for his experiments. What problems would he have had that he ...

Identify the alga known for biological activity called

Identify the alga known for biological activity called bioluminescence?

1 which type of vessels arteries or veins has more muscle

1) Which type of vessels, arteries, or veins, has more muscle fibers? What is the functional significance of this? 2) In general, we have no conscious control over smooth muscle or cardiac muscle function, whereas we can ...

Which phylloclade commonly found in xerophytic plants that

Which phylloclade commonly found in xerophytic plants that is modified?

The primary goal of the reproductive system is the

The primary goal of the reproductive system is the production of a new human being. Let's consider each step of that process, beginning with the formation of gametes (sperm and eggs) and ending with birth. Can someone st ...

What is the basic building block of a sanitary landfill how

What is the basic building block of a sanitary landfill? How is it constructed? Make a sketch to illustrate your answer. What kind of equipment or machinery is used to construct and operate a landfill?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen