Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Assignmentuse what we have learned about biomimicrycreate a

Assignment Use what we have learned about biomimicry Create a 1 page document- "Working Towards a Sustainable Society" Project: • Develop a thesis statement- then back that up with ways we can get there. • Describe the c ...

What are the transcription factors important for muscle

What are the transcription factors important for muscle development? i.e. There are different steps to get a muscle fiber, what are the transcription factors that are important for these steps?

Over half of the bodys glucose is metabolized in the brain

Over half of the body's glucose is metabolized in the brain. Very few of the alternate fuels are used in the brain, but are commonly used by other parts of the body. Muscles increase their use of glucose with increasing ...

Imagine you do a test cross between a purple-flowered pea

Imagine you do a test cross between a purple-flowered pea plant having serrated leaves (a dominant trait) and a white-flowered pea plant having smooth edges. If the purple-flowered plant is heterozygous for both traits, ...

You have been in hr for 8 years three weeks ago you joined

You have been in HR for 8 years. Three weeks ago you joined your third employer, Chicken Pluckers, Inc., as HR Manager. Chicken Pluckers is a family-owned, meat processing plant with 400 employees. Your new boss, the CEO ...

A foreign america executive finds that a foreign subsidiary

A foreign America executive finds that a foreign subsidiary in a poor nation has hired a 12-year-old girl to work on a factory floor, In violation of the company's prohibition on child labor. He tells the local manager t ...

What are two ecosystems in the region where you live

What are two ecosystems in the region where you live (Southeastern US) where you live? What are some examples of intrinsic and instrumental values provided by the ecosystems?

Of the four chambers of the human heart which has the

Of the four chambers of the human heart, which has the thickest walls, and why? Why can you not catch the same cold twice, but a new cold will make you sick for a week or two? What is the key step in spermatogenesis that ...

Of the four chambers of the human heart which has the

Of the four chambers of the human heart, which has the thickest walls, and why? Why can you not catch the same cold twice, but a new cold will make you sick for a week or two? What is the key step in spermatogenesis that ...

A multicellular lifeform has a weird type of cell in its

A multicellular lifeform has a weird type of cell in its body. This cell has a high density of peroxisomes. What is the most reasonable function of this cell? Functions for redox reactions Functions for digestion Functio ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro