Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Bacterial srnas activate and repress translation by

Bacterial sRNA's activate and repress translation by exposing or covering RBS (ribosome binding site) on mRNA. Riboswitches also activate and repress translation by exposing or covering RBS on mRNA. How do these two regu ...

Suppose you are performing an experiment in which you must

Suppose you are performing an experiment in which you must use heat to denature a double helix and create two single stranded pieces. Based on what you know about nucleotide bonding, do you think the nucleotides will all ...

Plants pend towards the source of of light on account of

Plants pend towards the source of of light on account of the movement curvature called?

If instead of making an energy drink you come up with an

If instead of making an energy drink, you come up with an energy injection, how would that affect the ingredients you put into the shot? Think in terms of polarity and tonicity.

Please refer to the following interactive map as you

Please refer to the following interactive map as you complete this activity: http://worldpopulationhistory.org/map/2050/mercator/1/0/25/  Here are instructions for how to read the map: http://worldpopulationhistory.org/h ...

Select one of the topics research the topic thoroughly and

Select One of the Topics, Research the Topic Thoroughly and Write a Concise Research Paper Companion Animal Medicine Most of the concepts that apply to humans also apply to our companion animal friends, an important thin ...

In preparation for this assignment please visit each of the

In preparation for this Assignment, please visit each of the following websites to learn about how HIV wreaks havoc on the human immune system. Aids.gov. Overview of HIV Treatments. Retrieved fromhttps://aids.gov/hiv-aid ...

Explain the hierarchy of plant structure using the root as

Explain the hierarchy of plant structure using the root as an example organ and follow it through each stage until you reach the level of cell. Only use the vascular tissue systems.

Assignmentshort answeressay write your answers and submit

Assignment Short Answer ESSAY. Write your answers and submit assignment via the attachment. Please be specific and use examples from the textbook when appropriate 1) What 4 factors do you think should be taken into consi ...

How might 32p and 35s be used to demonstrate that the

How might 32P and 35S be used to demonstrate that the transforming principle is DNA? Briefly outline an experiment that would show that DNA rather than protein is the transforming principle.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen