Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Assignmentsimmunology1st assignmentsection ithe following

Assignments Immunology 1st Assignment Section I. The following Topics 1-3 (of 4) cover the cell isolation protocols from Units 1 & 2: Assigned Appendix readings; Isolation of human monocytes by double gradient centrifuga ...

Genetics and inheritancereview information on genetic

Genetics and Inheritance Review information on genetic disorders on the National Human Genome Research Institute Site:http://www.genome.gov/. Choose a genetic disorder that can be inherited from a parent. Write a 525- to ...

Part anbspdefine each vocabulary word in the following

Part A  Define each vocabulary word in the following table. Use your textbooks or an outside source as references. Provide examples where requested, use complete sentences, and be clear and concise when explaining your a ...

Assignmentpart 1backgroundwhen you look around at the world

Assignment Part 1 Background When you look around at the world, you can see many examples that demonstrate how an object's or a system's structure relates to its function. The structure of a highway system, for example, ...

Assignment lasa organisms in your biomein this assignment

Assignment: LASA: Organisms in Your Biome In this assignment, you will create a Microsoft PowerPoint presentation that exhibits the different organisms in your current biome. Include the following in your presentation: • ...

1 which karyotypes shows a normal male individual ie a male

1. Which karyotype(s) shows a "normal" male individual (i.e., a male individual with no trisomies or monosomies)? A. A and B B. B only C. C only D. D only E. A, B, C & D 2. Which karyotype(s) shows an individual with Tur ...

Organic chemistry1 there is an attachement with 24

Organic Chemistry 1. There is an attachement with 24 molecules. Make three classification based on the function group. 2. Fill out the chart in the attactment. Complete the flowchart for the separation and isolation of: ...

Assignment anatomy amp physiologydirections be sure to

ASSIGNMENT: Anatomy & Physiology Directions: Be sure to save an electronic copy of your answer before submitting it to Ashworth College for grading. Unless otherwise stated, answer in complete sentences, and be sure to u ...

1 what do primatologists study to trace evolution do they

1. What do primatologists study to trace evolution? Do they observe primates in natural environments or in captivity? 2. What are the 2 most common ethical concerns that primatologists face? 3. What are the 8 characteris ...

Human biology1describe the chemical digestion that occurs

HUMAN BIOLOGY 1. Describe the chemical digestion that occurs in the mouth (one sentence). 2. What is the difference between a) the pharynx and the larynx and b) the esophagus and the trachea? 3. Cancer patients often get ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate