Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Imagine two parents are both heterozygous for two autosomal

Imagine two parents are both heterozygous for two autosomal genes. Assuming independent assortment, what proportion of their offspring are expected to have the same phenotype (for these two traits) as the parents? A) 0.2 ...

What is the most common dna repair system in humans

What is the most common DNA repair system in humans, involving enzymatic functions and replacement of damaged DNA bases?

Environmental science final projectcreate hour to hour and

Environmental Science Final Project Create hour to hour and half long POWER POINT lecture (20-25 slides) using the following topics: Human Population Dynamics, Recent Climate Change, Ozone in the Atmosphere and they Hyrd ...

Assignmentlife offers us choices and what an older part of

Assignment Life offers us choices, and what an older part of the forebrain, the limbic system, chooses is to feel better right away. The conscious forebrain, the cerebral cortex, knows that this can be short-sighted and ...

Assignment gene technologygene technology carries with it

Assignment: Gene Technology Gene technology carries with it social and ethical implications-many of which engender personal views and discussion. Select one of the following biotechnology topics to write about: • Genetic ...

For this assignment you will select 4 fermented foods to

For this assignment, you will select 4 fermented foods to include in a full course dinner menu. Not every dish in the menu needs to be fermented, but 4 fermented products have to be included. The menu should have an appe ...

1 describe the three classes of carcinogens and their sub

1. Describe the three classes of carcinogens and their sub classes; describe the role each plays in the cancer process and give chemical examples. 2. Describe six points in the cancer process where the process can be inh ...

Explain how these electrical currents of epsps and ipsps

Explain how these electrical currents of EPSPs and IPSPs are used in spatial and temporal summation to initiate or inhibit the generation of an action potential.

Short plant height is a recessive trait tt if a gardener

Short plant height is a recessive trait (tt). If a gardener wants to breed only short plants, will she succeed if she simply removes all tall plants from the breeding population? Why or why not?

The splitting of white light into its constituent colours

The splitting of white light into its constituent colours passing through a prism is known as?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro