Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

Compare and contrast spermatogenesis and oogenesis in

Compare and contrast spermatogenesis and oogenesis in humans.

How does complementary base pairing facilitate dna

How does complementary base pairing facilitate DNA replication and the processes of transcription and translation? Identify the base pairs in each process.

You are studying which of the multiple steps in gene

You are studying which of the multiple steps in gene expression you could tweak in order to produce a normal version of the huntingtin protein despite having the allele with the mutation. Which step in gene expression wo ...

Hans had had a strep throat two weeks before he was to

Hans had had a strep throat two weeks before he was to start anew job. He had to complete some work before he could resign fromhis old position so he ignored the bacterial infection. In thefirst week of his new job he no ...

State which cells in a human testis produce testosterone

State which cells in a human testis produce testosterone and its function(s) and state which hormones are produced by a human ovary, and their functions.

Discuss the mechanisms and consequences of adh and

Discuss the mechanisms and consequences of ADH and aldosterone on the kidneys

Elisa uses an enzyme-linked antibody to detect and antigen

ELISA uses an enzyme-linked antibody to detect and antigen. Briefly explain how use of the enzyme is ELISA could amplify the detection of a very small amount of antigen in a sample.

Determining whether clean groundwater has become dirty and

Determining whether clean groundwater has become dirty and what caused any contamination is a complex pursuit. Stephen Osborn and three colleagues from Duke University set out to learn whether drinking water was really b ...

1 explain how insulin regulates glucose levels in the

1. Explain how insulin regulates glucose levels in the blood? 2. What is unique about the glands of the endocrine system?

Gene technologygene technology carries with it social and

Gene Technology Gene technology carries with it social and ethical implications-many of which engender personal views and discussion. Select one (1) of the following biotechnology topics to write about:  Genetically modi ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen