Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 


Related Questions in Biology

A researcher creates a drug that blocks ca channels what

A researcher creates a drug that blocks Ca channels. what would be prevented by this drug in muscle contracion.

Formatnbsp at least one page in length 1-inch margins size

Format:   At least one page in length, 1-inch margins, size 11 font, double spaced.  Sources:   All sources must be properly cited within  and  at end of paper. Use MLA or APA style. Please do the following: Go to the in ...

Question 1some parts of the brain that belong to the limbic

Question 1 Some parts of the brain that belong to the limbic system are the a) amygdala and hippocampus b) basal ganglia and cingulate cortex. c) thalamus and hypothalamus. d) pons, cerebellum, and medulla oblongata. Que ...

Nutrition amp metabolismdefine nutrient and list the six

Nutrition & Metabolism Define nutrient and list the six major categories of nutrients Know the most abundant macronutrients Define the absorptive and post-absorptive states. In which state is the body storing excess fuel ...

What characteristics of sahelanthropus tchadenssis exclude

What characteristics of Sahelanthropus tchadenssis exclude it from being considered human?

Please describe four different categories of tissue

Please describe four different categories of tissue engineering strategies for repairing bone and cartilage injuries separately, and compare the advantages and disadvantages of these strategies.

Cyclin-dependent kinases are special molecules that

Cyclin-dependent kinases are special molecules that facilitate the progression of a cell through the cell cycle. Many molecules such as p53 regulate the cell cycle. An unregulated cell cycle can lead to rapid growth of t ...

If instead of making an energy drink you come up with an

If instead of making an energy drink, you come up with an energy injection, how would that affect the ingredients you put into the shot? Think in terms of polarity and tonicity.

1 the ductus arteriosus and the ductus venosus are two key

1) The ductus arteriosus and the ductus venosus are two key vessels in the fetal circulation that are absent in the adult circulation. What are their function in the fetus? Why are they necessary? 2) At birth, the fetal ...

Ocean systemsaccording to the law of conservation of energy

Ocean Systems According to the law of conservation of energy, energy cannot be created or destroyed, but it can change from one form to another 1. A boy doing a cannonball into the pool. He went from potential to kinetic ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro