Ask Question, Ask an Expert


Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 

Related Questions in Biology

Contrast the different types of stem cells including pros

Contrast the different types of stem cells, including pros and cons of each.

All cells on earth use mrna to make protein rather than

All cells on Earth use mRNA to make protein rather than using DNA directly. Why is it more advantageous to make protein from mRNA rather than directly from DNA in prokaryotic cells?

Biology questions1 what were the characteristics of the pea

Biology questions 1. What were the characteristics of the Pea plant that enabled Mendel to do his experiments? 2. How does probability and chance play an important role in genetics? 3. Explain the difference between gene ...

Imagine you do a test cross between a purple-flowered pea

Imagine you do a test cross between a purple-flowered pea plant having serrated leaves (a dominant trait) and a white-flowered pea plant having smooth edges. If the purple-flowered plant is heterozygous for both traits, ...

1 describe the difference between a tumor suppressor gene a

1. Describe the difference between a tumor suppressor gene, a proto-oncogene, and an oncogene. Provide an example of each. 2. Cervical cancer is mainly caused by human papilloma viruses (HPVs). Explain how viruses contri ...

1 how does the structure of dna double helix determine how

1. How does the structure of DNA (double helix) determine how the genetic information is passed on? 2. How does the cell use the information contained in the DNA to construct proteins (transcription and translation)?

The ability of a person to roll their tongue is controlled

The ability of a person to roll their tongue is controlled by a single gene with two alleles. About 65% of people have the dominant allele, and can therefore roll their tongue. Stephanie cannot roll her tongue. Without y ...

Gene technologygene technology carries with it social and

Gene Technology Gene technology carries with it social and ethical implications-many of which engender personal views and discussion. Select one (1) of the following biotechnology topics to write about:  Genetically modi ...

Give an example of pairs that can be mixed together to make

Give an example of pairs that can be mixed together to make a budget solution?

What is the difference between mortality and reproductive

What is the difference between mortality and reproductive rates? Do you think that they equally make an impact on population growth? If yes or no, why?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen