Each of the following pairs of primers have a problem with, Ask an Expert

Academics

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'
reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'
reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M928336

Have any Question?Write your Review or question?

Related Questions in Biology

What changes would you expect to see in the liver cells of

What changes would you expect to see in the liver cells of someone suffering from chronic alcoholism?

What are the equations for molarity molality density ppm

What are the equations for Molarity, molality, density, ppm, ppb, mass percent, Volume percent, and mole percent?

Question phytoplankton chemosynthesis and mitochondriafor

Question: "Phytoplankton, Chemosynthesis, and Mitochondria" For your primary post, please respond to one of the following three topics with a post of at least 125 words that addresses each point given in the instructions ...

Bioinformatics assignment -in this assignment should check

Bioinformatics Assignment - In this assignment should check the following sequence and test whether it has the following restriction cut sites. This searching should be done globally, that is, it should check for all pos ...

What is the difference between systole and diastole and how

What is the difference between systole and diastole, and how do they relate to Systolic blood pressure and diastolic blood pressure?

Pleasehelp me to answer this question fill in the blankin

PLEASE help me to answer this question: Fill in the blank In sexually reproductive organisms, mutations must occur in the ________ in order to be passed on to the next generation.

Which are the logical steps proposed by margulis that would

Which are the logical steps proposed by Margulis that would help explain why the accumulation of oxygen in the atmosphere led to the evolution of mitochondria.

Duchenne muscular dystrophy md is a recessive sex-linked

Duchenne muscular dystrophy (md) is a recessive, sex-linked inherited disease in humans. A cross between a normal man and a woman who is a carrier of this trait, what are the odds that a sons or daughters would have MD? ...

The allele for hitchhikers thumb is recessive to the

The allele for hitchhiker's thumb is recessive to the dominant straight thumb. In a population of 500 students, 25% have hitchhiker's thumb. How many students would you expect to be homozygous dominant for the trait?

Igfbp2 rbp4 and factor d post bariatric surgeryigfbp2 what

IGFBP2/ RBP4 and Factor D Post Bariatric Surgery IGFBP2 ( what the normal physiological action in the body? And how it affectedby obesity? andpost bariatric surgery?) RBP4 (what the normal physiological action in the bod ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert