Ask Question, Ask an Expert


Ask Biology Expert

1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

2- Each of the following pairs of primers have a problem with it. Tell why the primers would not work well.

a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'
reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'

c) Forward primer 5' TCGAATTGCCAATGAAGGTCCG 3'

Biology, Academics

  • Category:- Biology
  • Reference No.:- M928336

Have any Question? 

Related Questions in Biology

Part anbspdefine each vocabulary word in the following

Part A  Define each vocabulary word in the following table. Use your textbooks or an outside source as references. Provide examples where requested, use complete sentences, and be clear and concise when explaining your a ...

Please answer the questions below providing references to

Please answer the questions below providing references to support claims Is it is essential that DNP-prepared leaders understand their organization's political and strategic system processes? What are the four steps of t ...

Disscussion board biologybiotechnology allows the use of

Disscussion Board Biology Biotechnology allows the use of living organisms or their processes for human needs or purposes. Currently, this topic includes such general examples as cloning, stem cells (adult, umbilical cor ...

For each of the following questions assume only one cycle

For each of the following questions, assume only one cycle of the TCA is completed during the course of the experiment. a) Oxaloacetate labeled at C4 with the radioactive isotope 14C is added to a suspension of respiring ...

Genetics and reproductioncreate at least a 350-word blog

Genetics and Reproduction Create at least a 350-word blog post in Microsoft® Word in response to the following question: Female copperhead snakes have the ability to reproduce both sexually and asexually. In your opinion ...

Human biology1describe the chemical digestion that occurs

HUMAN BIOLOGY 1. Describe the chemical digestion that occurs in the mouth (one sentence). 2. What is the difference between a) the pharynx and the larynx and b) the esophagus and the trachea? 3. Cancer patients often get ...

Answer in a word or sentence1 what is decibel name any one

Answer in a word or sentence: 1. What is decibel? Name any one source that can produce noise of about 120 decibel. 2. What are the effects of smog on plants? 3. Define Pollutants with any one example. 4. What is acid rai ...

Experiment answer sheetsummary of activities for week 6

EXPERIMENT ANSWER SHEET SUMMARY OF ACTIVITIES FOR WEEK 6 EXPERIMENT ASSIGNMENT • Experiment 6 Exercise 1 - Monhybrid Crosses • Experiment 6 Exercise 2 - Dihybrid Cross • Experiment 6 Exercise 3 - Inheritance of Human Tra ...

In this assignment you will be writing a 1000-1250-word

In this assignment, you will be writing a 1,000-1,250-word essay describing the differing approaches of nursing leaders and managers to issues in practice. To complete this assignment, do the following: nursing shortage ...

Lab an introduction to genetic processespart a dna

Lab: An Introduction to Genetic Processes Part A: DNA Replication and Protein Synthesis and Sources of Variability Exercise Exercise 1 . Illustrate your understanding of complimentary bases and DNA Replication by providi ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate