Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

How does complementary base pairing facilitate dna

How does complementary base pairing facilitate DNA replication and the processes of transcription and translation? Identify the base pairs in each process.

1 much pharmaceutical research targets developing

1. Much pharmaceutical research targets developing anti-cancer drugs that can effectively stimulate the methylation of DNA. Formulate a possible hypothesis to explain why DNA methylation might be an effective anticancer ...

Why is it that n2 content is kept constant in the

Why is it that N2 content is kept constant in the biosphere?

What is the role of abiotic factors in an ecosystem in

What is the role of abiotic factors in an ecosystem? In other words, how do they affect food webs? Why is it easier to classify protists by methods of nutrition and movement than by habitat (where they live)? Briefly exp ...

Biodiesel fuel is produced from oils synthesized by and

Biodiesel fuel is produced from oils synthesized by and harvested from living plants. How does the use of biodiesel fuel compare to the use of fossil fuels with respect to the amount of carbon dioxide released into the a ...

Some boxers and wrestlers dehydrate abruptly by spending

Some boxers and wrestlers dehydrate abruptly by spending time in a sauna and sweating a lot in order to lose weight and compete with a lower tier, however this is a serious health hazard, explain what happens to the toni ...

Which component of a muscle does the ca combine with to

Which component of a muscle does the Ca^++ combine with to allow a contraction to occur? When a muscle is simulated before the muscle can fully relax, it can cause muscle twitch tetarus muscle tendritis When a muscle is ...

Transgenic organismsthe development of transgenic organisms

Transgenic Organisms The development of transgenic organisms is an established technique in many laboratories. A transgenic organism is an organism that includes DNA from another organism in the cells of its body. This D ...

The protein produced by huntingtons disease huntingtin

The protein produced by Huntington's disease (huntingtin) interferes with general transcription factor (called CBP) and prevents it from binding the promoter. CBP activates genes involved in cell survival. i) Which step ...

Discuss the need for modern society to shift to a paradigm

Discuss the need for modern society to shift to a paradigm of Sufficiency, within which just and sustainable wellbeing for all of creation becomes the norm. How can this be achieved on an Earth That Is Full? Include cons ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro