Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

Biology class must cite work must be 250 wordsyoutube url

Biology class. Must cite work, must be 250 words. YouTube URL: http://www.youtube.com/watch?v=rjza24Oyalc Dieters often talk about their metabolism. What is metabolism? Catabolism? Anabolism? Total metabolic rate (TMR)? ...

1 identify list the two basic types of cells2 would you

1. Identify (list) the two basic types of cells. 2. Would you find proteins inside cells or cells inside proteins? (choose one answer) 3. What two things make osmosis a special type of diffusion? 4. What is a selectively ...

Sample presentation is on prezi but you are to make it in

Sample presentation is on Prezi but you are to make it in powerpoint and I will turn into SOM: Here is the link to the sample presentaiton: https://prezi.com/qxkyp68j_oqc/hot-headed-ice-borer/ Presentation requirements: ...

Questionkayla brings riley now 18 months in for complaint

Question: Kayla brings Riley, now 18 months in for complaint of fever and cough. The fever began 3 days ago and is of normal levels in the morning then gets as high as 100 to 101 degrees in the afternoons. Riley has also ...

Assuming an od600 of 100 4 x 108 bacterial cellsml or the

Assuming an OD600 of 1.00 = ~ 4 x 108 bacterial cells/ml (OR the value provided by your TA), calculate the number of cells in your original undiluted bacterial suspension.

You have been asked to investigate a new procedure that

You have been asked to investigate a new procedure that physicians would like nurses to adopt in the hospital. Discuss the process you would apply to determine whether the procedure falls within the RN scope of practice ...

Part 1 relevance of evolution medicine1 what is causing

Part 1: Relevance of Evolution: Medicine 1. What is causing the evolutionary arms race with pathogens? Provide an example to illustrate your answer. 2. How can we slow down antibiotic resistance? 3. What is the evolution ...

Provide a 15 page single space in apa style reflection of

Provide a 1.5 page "single space" in APA style reflection of the video (Escape Fire The Fight to Rescue American Healthcare) https://www.youtube.com/watch?v=qkZlFMuVShE Respond to each of the following statements based o ...

Please answer the questions below providing references to

Please answer the questions below providing references to support claims Is it is essential that DNP-prepared leaders understand their organization's political and strategic system processes? What are the four steps of t ...

Assignment anatomy amp physiologydirections be sure to

ASSIGNMENT: Anatomy & Physiology Directions: Be sure to save an electronic copy of your answer before submitting it to Ashworth College for grading. Unless otherwise stated, answer in complete sentences, and be sure to u ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate