Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

How do energy and nutrients move through ecosystems

How do energy and nutrients move through ecosystems? Indicate whether each is recycled. Define trophic levels and explain their involvement/role in energy movement.

Discussion topicolder people die for a number of reasons

Discussion Topic Older people die for a number of reasons: cancer, heart failure, complications due to diabetes, stroke, Alzheimer's, etc. Often times, the way we live our lives affect not only how long we live but what ...

Assignmentlife offers us choices and what an older part of

Assignment Life offers us choices, and what an older part of the forebrain, the limbic system, chooses is to feel better right away. The conscious forebrain, the cerebral cortex, knows that this can be short-sighted and ...

What is produced by inflation of the apex of the

What is produced by inflation of the apex of the conidospore and later the inflated apex is separated by a septum?

Sickle cell anemia is a very severe conditiona explain the

Sickle cell anemia is a very severe condition. a) Explain the condition and the alleles of the person with the condition and why it is a serious problem; b) What type of chromosomal disorder causes the condition; c) If t ...

Clearly explain why health outcome is so much more than a

Clearly explain why health outcome is so much more than a combination of health care, individual behaviors, and/or genetics?

Antimicrobial resistance and natural selectionthe use of

Antimicrobial Resistance and Natural Selection: The use of antimicrobial drugs began during the World War II era. After more than 50 years of widespread use, many antimicrobial drugs have become ineffective. Health autho ...

For this assignment you will select 4 fermented foods to

For this assignment, you will select 4 fermented foods to include in a full course dinner menu. Not every dish in the menu needs to be fermented, but 4 fermented products have to be included. The menu should have an appe ...

Huntingtons disease affects individuals late into adulthood

Huntington's disease affects individuals late into adulthood. Given what you know about how Natural Selection works, explain why Huntington's disease hasn't been eradicated from the population.

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen