Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

Evidence into diabetic care practicebased on the summary of

Evidence into Diabetic Care Practice Based on the summary of research findings identified from the Evidence-Based Project-Paper on Diabetes that describes a new diagnostic tool or intervention for the treatment of diabet ...

Once the hypothalamus has detected low levels of calcium in

Once the hypothalamus has detected low levels of calcium in the bloodstream, describe the full cascade of events that leads to low bone density. Also describe the cascade that allows the dairy product to contribute to ci ...

If human activity or natural activity hurricanes destroys a

If human activity or natural activity (hurricanes) destroys a certain species, what consequence might this have on the environment?

Microbiology1 for what specific purpose was gram staining

Microbiology 1. For what specific purpose was gram staining developed for? what is it used for today? 2. Why is the presence of air bubbles a sign of contamination? 3. Why is a gram stain helpful when monitoring bacteria ...

As we get older we are prone to many conditions that affect

As we get older we are prone to many conditions that affect our bones, muscles and nerves. In your opinion how can these conditions be prevented?

Elisa uses an enzyme-linked antibody to detect and antigen

ELISA uses an enzyme-linked antibody to detect and antigen. Briefly explain how use of the enzyme is ELISA could amplify the detection of a very small amount of antigen in a sample.

What is the difference between mortality and reproductive

What is the difference between mortality and reproductive rates? Do you think that they equally make an impact on population growth? If yes or no, why?

The primary goal of the reproductive system is the

The primary goal of the reproductive system is the production of a new human being. Let's consider each step of that process, beginning with the formation of gametes (sperm and eggs) and ending with birth. Can someone st ...

Given what you know about how natural selection works

Given what you know about how Natural Selection works, explain why Sickle cell disease hasn't been eradicated from the population.

1 what are the benefits of sequencing the genome of an

1) What are the benefits of sequencing the genome of an organism? Explain by giving 3 examplesfor the applications of genomic information. 2) Why do not modern apes become human today? World limit is between 250-400

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen