Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

Discussion boardthis is only a discussion board not an

Discussion Board This is only a discussion board, not an essay! please follow all the instructions and answer the questions within the bullet that you chose. "Evolution of Animals and Population of Humans" Note: Online s ...

Discussion topicolder people die for a number of reasons

Discussion Topic Older people die for a number of reasons: cancer, heart failure, complications due to diabetes, stroke, Alzheimer's, etc. Often times, the way we live our lives affect not only how long we live but what ...

If instead of making an energy drink you come up with an

If instead of making an energy drink, you come up with an energy injection, how would that affect the ingredients you put into the shot? Think in terms of polarity and tonicity.

How does dna polymerase facilitate the pcr

How does DNA polymerase facilitate the PCR reaction?

Imagine that you had 11000 of the worlds gross domestic

Imagine that you had 1/1000 of the worlds gross domestic product available at your disposal for conservation biology product? Is it a sound conservation decision to protect just 4% of the earth's living habitat? Why or w ...

Comp 7 bio 40 project reliability of metagenomics

Comp 7/ Bio 40 Project: Reliability of Metagenomics Reads Background In this class, we are studying 16S rRNA metagenomic sequencing, in which the sequences read come from one of the hypervariable regions of the 16S rRNA ...

Microbiology1 for what specific purpose was gram staining

Microbiology 1. For what specific purpose was gram staining developed for? what is it used for today? 2. Why is the presence of air bubbles a sign of contamination? 3. Why is a gram stain helpful when monitoring bacteria ...

What does precautionary principle mean how would you apply

What does precautionary Principle mean. How would you apply the concept of the Precautionary Principle to the unrestricted allowance of endocrine disrupters in consumer products?

Elaborate on the basic concepts involved in the regulation

Elaborate on the basic concepts involved in the regulation of fluids and electrolytes. Also, identify the hormones that play important roles in regulating fluid balance and electrolyte balance and describe their effects.

Imagine you do a test cross between a purple-flowered pea

Imagine you do a test cross between a purple-flowered pea plant having serrated leaves (a dominant trait) and a white-flowered pea plant having smooth edges. If the purple-flowered plant is heterozygous for both traits, ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro