Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

Assignment gene technologygene technology carries with it

Assignment: Gene Technology Gene technology carries with it social and ethical implications-many of which engender personal views and discussion. Select one of the following biotechnology topics to write about: • Genetic ...

In anotherchapter you will learn of evidence that primates

In anotherchapter, you will learn of evidence that primates, especially fossil species in the Hominin group that apparently led to our currentHomo sapiens sapiensspecies identity. Many of the fossils of pre-human species ...

How does complementary base pairing facilitate dna

How does complementary base pairing facilitate DNA replication and the processes of transcription and translation? Identify the base pairs in each process.

Please follow the rubric with the name tina jones

Please follow the rubric with the name tina jones 28-year-old female admitted to shadow general hospital for a right infected foot after cutting it on a ladder falling off a stepstool, turned into cellulitis. Treated in ...

Do you think there are political issues surrounding human

Do you think there are political issues surrounding human population growth? Why or why not? Can you give an example?

Discuss the need for modern society to shift to a paradigm

Discuss the need for modern society to shift to a paradigm of Sufficiency, within which just and sustainable wellbeing for all of creation becomes the norm. How can this be achieved on an Earth That Is Full? Include cons ...

What characteristics of sahelanthropus tchadenssis exclude

What characteristics of Sahelanthropus tchadenssis exclude it from being considered human?

Discuss the need for modern society to shift to a paradigm

Discuss the need for modern society to shift to a paradigm of Sufficiency, within which just and sustainable wellbeing for all of creation becomes the norm. How can this be achieved on an Earth That Is Full? Include cons ...

Question 1some parts of the brain that belong to the limbic

Question 1 Some parts of the brain that belong to the limbic system are the a) amygdala and hippocampus b) basal ganglia and cingulate cortex. c) thalamus and hypothalamus. d) pons, cerebellum, and medulla oblongata. Que ...

Discuss the similarities and differences between arteries

Discuss the similarities and differences between arteries, veins, and lymphatic vessels. Be sure to include size, tissue layers, and any other structural components.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen