Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

Write a paper about pandainstruction is given belowbullyour

Write a paper about PANDA. Instruction is given below. • Your position paper should be from 3 pages in length! (Reference page excluded) • Provide evidence as to why the animal has become endangered and emphasize the eff ...

What are the differences between the roles of mainstream

What are the differences between the roles of mainstream and alternative health care providers? Do you feel that these types of health care workers are given the respect as professionals that they deserve? Why, or why no ...

During the separation of the different photosynthetic

During the separation of the different photosynthetic pigments of spinach by paper chromatography, how did you know which of the pigments was the least polar? It travelled the farthest on the paper (was the first pigment ...

You have been in hr for 8 years three weeks ago you joined

You have been in HR for 8 years. Three weeks ago you joined your third employer, Chicken Pluckers, Inc., as HR Manager. Chicken Pluckers is a family-owned, meat processing plant with 400 employees. Your new boss, the CEO ...

Identify the alga known for biological activity called

Identify the alga known for biological activity called bioluminescence?

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

What are the steps in the process of creating a safe

What are the steps in the process of creating a safe schools/health student initiative?

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

What principles a health care practitioner should follow

What principles a health care practitioner should follow during the participation in media?

1 how does the structure of dna double helix determine how

1. How does the structure of DNA (double helix) determine how the genetic information is passed on? 2. How does the cell use the information contained in the DNA to construct proteins (transcription and translation)?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen