Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

What is the difference between cis-acting elements and

What is the difference between cis-acting elements and trans-acting factors in the regulation of DNA?

Do you think there are political issues surrounding human

Do you think there are political issues surrounding human population growth? Why or why not? Can you give an example?

Select at least 2 cell structures what hypothesis could you

Select at least 2 cell structures. What hypothesis could you form to explain what would happen to the cell or the organism if each cell structure were damaged or destroyed?

What is formed by enlargement and rounding off of terminal

What is formed by enlargement and rounding off of terminal cells of a hypha?

Scenario please read and answer the following questions

Scenario: Please read and answer the following questions using critical thinking: The consumption of alcohol by a pregnant woman can cause a complex of birth defects called Fetal Alcohol Syndrome (FAS). These symptoms in ...

1 define polymerase chain reaction pcr demonstrate one

1. Define polymerase chain reaction (PCR). Demonstrate one cycle of the PCR process starting with one piece of DNA fragment. In the drawing, label template DNA, primers, dNTPs, and DNA polymerase. 2. Compare and contrast ...

In the video on the effect of exercise on cells it was

In the video on the effect of exercise on cells, it was pointed out that people who exercised regularly had younger cells. The researchers looked for a marker in volunteer's blood. They found "strands" and surmised that, ...

Please solve the problems with correct answers instead of

PLEASE SOLVE THE PROBLEMS WITH "correct" answers, instead of just writing answers. (1) Halophytes are plants that live in moist soils with high salt concentrations. Despite being surrounded my water, halophytes are often ...

If we maintain a strict biological definition of species h

If we maintain a strict biological definition of "species", H. Sapiens and H. Neanderthalensis were NOT seperate species as they successfully interbred. What impact might this information have on assigning a date to the ...

What is photosynthesis and what is the pigment for it to

What is photosynthesis and what is the pigment for it to take place?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen