Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

Name a process that occurs when dna is released by a broken

Name a process that occurs when DNA is released by a broken or lysed bacterium is taken up by another bacterium through its cell membrane giving this bacterium new traits

What is the most common dna repair system in humans

What is the most common DNA repair system in humans, involving enzymatic functions and replacement of damaged DNA bases?

You have been in hr for 8 years three weeks ago you joined

You have been in HR for 8 years. Three weeks ago you joined your third employer, Chicken Pluckers, Inc., as HR Manager. Chicken Pluckers is a family-owned, meat processing plant with 400 employees. Your new boss, the CEO ...

How does the presence of nitrate phosphate and ammonium

How does the presence of nitrate + phosphate and ammonium ions affect fertilization?

The branch of agriculture which deals with the feeding

The branch of agriculture which deals with the feeding, shelter, health and breeding of the domestic animals is called?

1 explain how insulin regulates glucose levels in the

1. Explain how insulin regulates glucose levels in the blood? 2. What is unique about the glands of the endocrine system?

Assignmentlife offers us choices and what an older part of

Assignment Life offers us choices, and what an older part of the forebrain, the limbic system, chooses is to feel better right away. The conscious forebrain, the cerebral cortex, knows that this can be short-sighted and ...

One more as soon as possible if you can please thank youthe

One more, as soon as possible if you can please! Thank you The technical advances covered in Chapter 15 are creating a host of medical and moral issues that we will all have to confront. Briefly discuss the four major as ...

Answer the following questionwhat is the domain and kingdom

Answer the following question: What is the domain and kingdom for an organism that has a nucleus, is not motile, and does not perform photosynthesis? What is taxonomy? What role does this serve? How does taxonomy assist ...

1 give one hypothesis about the relationship between

1) Give one hypothesis about the relationship between protein sequence and protein color that you tested in the Aipotu I: Genetics & Biochemistry lab. 2) Give the genotype of each of the four starting strains of Aipotian ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen