Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

1 describe the formation of a cp air mass and then discuss

1. Describe the formation of a cP air mass and then discuss the typical weather it produces and the changes it undergoes as it travels across the Great Lakes and moves southward. 2. Describe the typical life cycle of a m ...

Describe the performance of a urinalysis including

Describe the performance of a urinalysis, including equipment.

1 uterine contractions that are irregular and brief that

1) Uterine contractions that are irregular and brief that occur toward the end of gestation are called ________. 2) The hollow cavity within the blastocyst is the ________. 3) The process by which a viable embryo is form ...

Biology1 what is the difference of fatty acid beta

Biology 1. What is the difference of fatty acid β oxidation in mitochondrion versus peroxisome? Why such a difference exists? 2. (a) Write down the structure of arachidonic acid (C20:4 Δ5,8,11,14). (b) What do you expect ...

We all see animals in our day to day lives choose a

We all see animals in our day to day lives. Choose a behavior you saw exhibited by an animal. Explain your thoughts on the potential proximate and ultimate causes of the behavior.

Individual assignment instructionsthe global community is

Individual Assignment Instructions The global community is plagued by increasing incidence of lung cancer, colorectal cancer, breast cancer, pancreatic cancer, prostate cancer, leukemia, non-Hodgkin lymphoma, liver cance ...

Define nonrenewable resources and identify four examples

Define nonrenewable resources and identify four examples (only one energy source allowed).

Discussion topicolder people die for a number of reasons

Discussion Topic Older people die for a number of reasons: cancer, heart failure, complications due to diabetes, stroke, Alzheimer's, etc. Often times, the way we live our lives affect not only how long we live but what ...

Formatnbsp at least one page in length 1-inch margins size

Format:   At least one page in length, 1-inch margins, size 11 font, double spaced.  Sources:   All sources must be properly cited within  and  at end of paper. Use MLA or APA style. Please do the following: Go to the in ...

28 year old female with 2 day history of urinary frequency

28 year old female with 2 day history of urinary frequency, burning and pain upon urination, lower abdominal pain and vaginal discharge history of recurrent UTIs, chlamydia, gonorrhea x2 she has 3 children.

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro