Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

One of NASA land rovers returns from its mission with variety of samples. From one, a unique bacterial species was isolated and cultured. Your job is to examine whether or not the genetic code is overlapping or non-overlapping. Another researcher has discovered that rather than the codon of three nucleotides, this organism employed groups of four nucleotides. Demonstrate how you would make sure the presence of overlapping versus non-overlapping frames when you thought the codon was read in groups of three nucleotides and in groups of 4 nucleotides. How would you data have been dissimilar without the knowledge of codons as groups of four nucleotides?

Test mRNA sequence: AUUGGCCAAUUUACGGUAAUGGCCAAUUUACGGU

Biology, Academics

  • Category:- Biology
  • Reference No.:- M914981

Have any Question? 


Related Questions in Biology

How when where and why might you apply your learning of

How, when, where and why might you apply your learning of bioethics in the future if you wanted to be a veterinarian?

Discussion topicnatural selectiona novel fungicide is

Discussion Topic Natural Selection A novel fungicide is introduced and widely applied to cereal crops. After five years, resistant genotypes of the fungal pathogen are detected at a frequency of about 1%; resistance is w ...

Mrs smith is 50 years of age and is nervous about going

Mrs. Smith is 50 years of age and is nervous about going through menopause. How would you explain the process to her? What effects do estrogen and progesterone have on the vaginal mucosa? How does the effect of estrogen ...

Is it appropriate to say that all changes in the nucleotide

Is it appropriate to say that all changes in the nucleotide sequence of protein-encoding DNA result in new alleles? Explain. (This is sort of a judgment call. It depends on how broadly or narrowly you define the term all ...

Do some research and describe at least one specific example

Do some research and describe at least one specific example where antibiotic overuse has resulted in a negative effect. What was the effect of this overuse? How could this have been prevented? What do you think about ant ...

Identify and give functions of the organs and structures of

Identify and give functions of the organs and structures of the urinary system.

1 define polymerase chain reaction pcr demonstrate one

1. Define polymerase chain reaction (PCR). Demonstrate one cycle of the PCR process starting with one piece of DNA fragment. In the drawing, label template DNA, primers, dNTPs, and DNA polymerase. 2. Compare and contrast ...

1 how is gene expression regulated give three different

1. How is gene expression regulated (give three different forms of regulation mechanisms)? 2. How does gene regulation relate to cancer development?

Ocean systemsaccording to the law of conservation of energy

Ocean Systems According to the law of conservation of energy, energy cannot be created or destroyed, but it can change from one form to another 1. A boy doing a cannonball into the pool. He went from potential to kinetic ...

What is the difference between the brain and cerebrumwhat

What is the difference between the brain and cerebrum? What are the main parts of these structures? How is the cerebrum anatomically divided? How is it structurally explained that the motor activity of the left side of t ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro