Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Biology Expert

DNA Region of 50 nucleotides has been sequenced in two different species.

Species 1 AATGCTGTGCCGAGCTAGCTAGTATGTTGCTAGCTAGATCGATCGACTGA

Species 2 GTAGCTATGCTGTGCTTGCTAGCATCTTTCTGGCTATATAGATTGATCCC

Calculate the observed Distance D at the molcular level betwee these tow sequeces, the correcteddistance by using jukes and cantors method jc and the corrected distance by using kimuras 2 parameter k2 method.If the same 2 sequences of 50 nucleoties shown are now with an addition of a third sequence species 3.

Species 1 AATGCTGTGCCGAGCTAGCTAGTATGTTGCTAGCTAGATCGATCGACTGA

Species 2 GTAGCTATGCTGTGCTTGCTAGCATCTTTCTGGCTATATAGATTGATCCC

Species 3 GTAGCTTTGCTGTGCTTGCTTGCATCTATCTGGGTATATAGTTTGATCCC

Compute the observed distance d at the molecular level between the three sequences and the corrected distance by using kimuras 2 parameter k2 method

drae two phylogenic trees depicting the relationships among these three using D and other tree using K2.

 

Biology, Academics

  • Category:- Biology
  • Reference No.:- M9350916

Have any Question?


Related Questions in Biology

A patient had abnormally low ch50 results ie abnormally low

A patient had abnormally low CH50 results (i.e., abnormally low lysis of antibody coated sheep red blood cells) would abnormally low levels of Bb explain the CH50 assay results? Why or Why not?

Write the null hypothesis for the effect of temperature on

Write the null hypothesis for the effect of temperature on catechol oxidase activity?

Question topic 2 article the cusp of a revolution in

Question: Topic 2 [article]: The cusp of a revolution in medicine. In a recent op-ed, Craig Venter (2)* shares his opinion that we are "on the cusp of a revolution" in medicine. (a) Describe three things that you learned ...

Question dietary recommendation and analysis projectin this

Question: Dietary recommendation and analysis project In this project, you will use software to analyze our own diet and make dietary recommendation. You will need submit a report. You can choose any of software if you f ...

One page highlighting the current state of federal

One page highlighting the current state of federal legislation for the use of stem cells

Why biologically is evolved resistance to crop pests

Why, biologically, is evolved resistance to crop pests inevitable?

What is the phenotypic ratio for the offspring of a mother

What is the phenotypic ratio for the offspring of a mother who is homozygous dominant for blonde hair and a blonde-haired father who is heterozygous.

You have been allocated a cdna accession number from the

You have been allocated a cDNA accession number from the NCB' database (see table below on page 2). Your task is to design experimental strategies that will allow you to: clone the cDNA in different expression vectors us ...

1 identify the maternal homolog for both chromosome 1 and 2

1.) Identify the maternal "homolog" for both Chromosome 1 and 2 and then the paternal homologs. Arrange these chromosomes as you would expect to find them during  G 1  of  interphase. What is the haploid number of our ce ...

The current scientific defination of standard temp and

The current scientific defination of standard temp and pressure (STP) is: 0 degrees C and 1.00 bar pressure of a gas, using ideal gas law calculate the volume In L occupied by 1 mol of an ideal gas under these condition( ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As