Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

What are the characteristics of tropical waters temperate

What are the characteristics of tropical waters, temperate waters and polar waters?

Select one chronic illness that could be diagnosed early in

Select one chronic illness that could be diagnosed early in life, such as asthma, diabetes, or rheumatoid arthritis. Follow a person with this chronic illness through the lifespan, discussing how treatment approaches wou ...

Write an essay on the differences and similarities of

Write an essay on the differences and similarities of creation science and intelligent design creationism, and how do they stand up as actual science?

Which genetic material was discovered by robert brown and

Which genetic material was discovered by Robert Brown and in which year.

Compare the path of an amino acid to that of a large fatty

Compare the path of an amino acid to that of a large fatty acid from absorption to delivery to a cell.

Formatnbsp at least one page in length 1-inch margins size

Format:   At least one page in length, 1-inch margins, size 11 font, double spaced.  Sources:   All sources must be properly cited within  and  at end of paper. Use MLA or APA style. Please do the following: Go to the in ...

Jerry coyne proposes a question at what point are the

Jerry Coyne proposes a question. At what point are the differences between populations large enough to make us call them different species? please answer question and defend answer.

You are an employee of an us firm that produces personal

You are an employee of an U.S. firm that produces personal computer in Thailand and then exports them to the United States and other countries for sale.  The personal computers were originally produced in Thailand to tak ...

Huntingtons disease affects individuals late into adulthood

Huntington's disease affects individuals late into adulthood. Given what you know about how Natural Selection works, explain why Huntington's disease hasn't been eradicated from the population.

What does ph measure how do these measurements vary between

What does pH measure? How do these measurements vary between acids and bases? How do buffers work, in terms of pH? In terms of your body, are there varying levels of pH? If so, why is this?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen