Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

Identifynbspan organism that lives within 50 miles of your

Identify  an organism that lives within 50 miles of your home. Write  a 1,050- to 1,400-word paper about how the organism has adapted to survive in their specific environment. Include the following points in your paper:  ...

Explain how resource partitioning led to character

Explain how resource partitioning led to character displacement in the interactions between the benthic and limnetic sticklebacks in Paxton Lake.

Mrs smith is 50 years of age and is nervous about going

Mrs. Smith is 50 years of age and is nervous about going through menopause. How would you explain the process to her? What effects do estrogen and progesterone have on the vaginal mucosa? How does the effect of estrogen ...

Urgent two immune system questionsactivated t-helper cells

URGENT: Two immune system questions: Activated T-helper cells aid in humoral immune responses by releasing cytokines which promote antibody production, phagocytosis, neutralization and apoptosis. Which parts of this stat ...

What are the ingredients in gatorade how does it provide

What are the ingredients in Gatorade how does it provide energy? In your opinion, should a person use this drink or supplement on a regular basis? Why or why not?

First present the characteristics of water that make it

First present the characteristics of water that make it capable of hydrogen bonding. Then discuss why water is a good solvent and so readily exhibits capillarity. Finally, examine the heat properties of water, specifical ...

What is the difference between cis-acting elements and

What is the difference between cis-acting elements and trans-acting factors in the regulation of DNA?

Compare and contrast spermatogenesis and oogenesis in

Compare and contrast spermatogenesis and oogenesis in humans.

Phylum arthropodathe earths largest phylum is arthropoda

Phylum Arthropoda The Earth's largest phylum is Arthropoda, including centipedes, millipedes, crustaceans, and insects. The insects have shown to be a particularly successful class within the phylum. What biological char ...

Imagine you do a test cross between a purple-flowered pea

Imagine you do a test cross between a purple-flowered pea plant having serrated leaves (a dominant trait) and a white-flowered pea plant having smooth edges. If the purple-flowered plant is heterozygous for both traits, ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro