Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

What is the relationship between the fields of taxonomy

What is the relationship between the fields of taxonomy, systematics and cladistics?

Discussion topicheart diseasenbspis the leading cause of

Discussion Topic Heart disease  is the leading cause of death in the United States. Almost 700,000 people die of heart disease in the U.S. each year. Heart disease is a term that includes several more specific heart cond ...

Sickle-cell anemia is caused by an abnormal hemoglobin

Sickle-cell anemia is caused by an abnormal hemoglobin molecule that changed the shape of red blood cells. This disease can lead to various health complications that are often lethal. However, heterozygous individuals ha ...

You have formulated a hypothesis mangoes contain more

You have formulated a hypothesis: "Mangoes contain more vitamin C than oranges." To test this hypothesis you measure vitamin C levels in 20 oranges and 20 mangoes from trees that were grown in the same orchard under the ...

1 define polymerase chain reaction pcr demonstrate one

1. Define polymerase chain reaction (PCR). Demonstrate one cycle of the PCR process starting with one piece of DNA fragment. In the drawing, label template DNA, primers, dNTPs, and DNA polymerase. 2. Compare and contrast ...

1 describe what would happen if all of your skeletal

1. Describe what would happen if all of your skeletal muscles contracted at the same time. 2. Describe the two separate metabolic needs that are met when a full-grown person eats a balanced diet.

Pleasenbspprovide an answer and your supporting

Please  provide an answer and your supporting explanation/reasoning for one  of the following questions: 1. What is the epigenome?  2. Why is important to study it?

Discuss the concept of risk and diversification and

Discuss the concept of risk and diversification and highlight types of risk correlation within portfolio with more than one asset?

Wellnessevaluate your own neighborhood and surrounding city

Wellness Evaluate your own neighborhood and surrounding city with regard to environmental factors related to wellness and connect your findings to the eight dimensions of wellesnn. Discuss as many environmental factors a ...

Select one chronic illness that could be diagnosed early in

Select one chronic illness that could be diagnosed early in life, such as asthma, diabetes, or rheumatoid arthritis. Follow a person with this chronic illness through the lifespan, discussing how treatment approaches wou ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen