Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

Create a table to compare and contrast the chemical

Create a table to compare and contrast the chemical reactions catalyzed by the following enzymes as well as their mechanisms of action. Your answer should include at least 5 of the following where appropriate: the stereo ...

Effect of catalase on hydrogen Effect of Catalase on Hydrogen Peroxide Introduction:

Effect of Catalase on Hydrogen Peroxide Introduction: Metabolism is the sum total of chemical reactions in the body that are necessary to the maintenance of life. Enzymes are biological catalysts that can speed up, and c ...

Human biology1where does lymph come from2list the primary

Human Biology 1. Where does lymph come from? 2. List the primary lymphatic organs. List the secondary lymphatic organs. 3. What structures allow the lymph to enter the cardiovascular system? 4. Why is the thymus so criti ...

Please answer the questions below providing references to

Please answer the questions below providing references to support claims Is it is essential that DNP-prepared leaders understand their organization's political and strategic system processes? What are the four steps of t ...

Adaptationlocate a diagram of that organism that has the

ADAPTATION Locate a diagram of that organism that has the main organs and structures labeled. Be sure to properly cite your diagram and pictures. Write a 1,050- to 1,400-word paper on this topic. • Briefly describe the e ...

Experiment answer sheetsummary of activities for week 6

EXPERIMENT ANSWER SHEET SUMMARY OF ACTIVITIES FOR WEEK 6 EXPERIMENT ASSIGNMENT • Experiment 6 Exercise 1 - Monhybrid Crosses • Experiment 6 Exercise 2 - Dihybrid Cross • Experiment 6 Exercise 3 - Inheritance of Human Tra ...

1 what do primatologists study to trace evolution do they

1. What do primatologists study to trace evolution? Do they observe primates in natural environments or in captivity? 2. What are the 2 most common ethical concerns that primatologists face? 3. What are the 8 characteris ...

Sample presentation is on prezi but you are to make it in

Sample presentation is on Prezi but you are to make it in powerpoint and I will turn into SOM: Here is the link to the sample presentaiton: https://prezi.com/qxkyp68j_oqc/hot-headed-ice-borer/ Presentation requirements: ...

Human biologydiscussion 1- identify and compare the two

Human Biology Discussion 1- Identify and compare the two major cardiovascular circuits in the human body. Include the purpose of each and the organs involved. Do not cut and paste information from the text or other sourc ...

Mutations can lead to missing or malformed proteins that

Mutations can lead to missing or malformed proteins that can lead to disease. A group of scientists in the United Kingdom have published a paper in the American Journal of Human Genetics stating that the average person h ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

A cola-dispensing machine is set to dispense 9 ounces of

A cola-dispensing machine is set to dispense 9 ounces of cola per cup, with a standard deviation of 1.0 ounce. The manuf

What is marketingbullwhat is marketing think back to your

What is Marketing? • "What is marketing"? Think back to your impressions before you started this class versus how you

Question -your client david smith runs a small it

QUESTION - Your client, David Smith runs a small IT consulting business specialising in computer software and techno

Inspection of a random sample of 22 aircraft showed that 15

Inspection of a random sample of 22 aircraft showed that 15 needed repairs to fix a wiring problem that might compromise

Effective hrmquestionhow can an effective hrm system help

Effective HRM Question How can an effective HRM system help facilitate the achievement of an organization's strate