Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

1 how does gel electrophoresis sort dna fragments2 if

1. How does gel electrophoresis sort DNA fragments? 2. If each individual has such a small amount of DNA, how do the bands on the gel contain enough DNA to be visible? 3. Many genes only have a few possible alleles. For ...

With which archaic human species did some of the ancestors

With which archaic human species did some of the ancestors of modern Europeans interbreed during the past 100,000 years?

What effect did grounding of the planes after 911 have on

What effect did grounding of the planes after 9/11 have on daily temperature ranges? Why was temperature affected?

What is the difference between mortality and reproductive

What is the difference between mortality and reproductive rates? Do you think that they equally make an impact on population growth? If yes or no, why?

Research the mode of inheritance for this diseasetrait why

Research the mode of inheritance for this disease/trait? Why? If you are not able to find a specific mode of inheritance, provide a hypothesis for the mode of inheritance. Explain your thinking here very thoroughly; this ...

What would be the expected genotypes and phenotypes of the

What would be the expected genotypes and phenotypes of the children and their relative frequencies from the following crosses a) NN X nn b) Nn x nn c) Nn x Nn d) nn x nn Where n represent gene for albinism and N represen ...

You are an employee of an us firm that produces personal

You are an employee of an U.S. firm that produces personal computer in Thailand and then exports them to the United States and other countries for sale.  The personal computers were originally produced in Thailand to tak ...

Due to the prospect of interplanetary travel how would you

Due to the prospect of interplanetary travel, how would you attempt to  Isolate  and  identify  a bacterial infection acquired on another planet. This bacteria is unknown to use and does not appear in  Bergey's  or the  ...

What alternative forms of energy should we be using in

What alternative form(s) of energy should we be using in Florida and why?

Bacterial srnas activate and repress translation by

Bacterial sRNA's activate and repress translation by exposing or covering RBS (ribosome binding site) on mRNA. Riboswitches also activate and repress translation by exposing or covering RBS on mRNA. How do these two regu ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro