Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

What is photosynthesis and what is the pigment for it to

What is photosynthesis and what is the pigment for it to take place?

Much genetic evidence indicates that humans and chimpanzees

Much genetic evidence indicates that humans and chimpanzees are very closely related, despite the observation that chimpanzees have 48 chromosomes and we have only 46. At first, the difference in chromosome number was co ...

How do we call insect which are responsible for

How do we call insect which are responsible for transmitting diseases?

Elaborate on the basic concepts involved in the regulation

Elaborate on the basic concepts involved in the regulation of fluids and electrolytes. Also, identify the hormones that play important roles in regulating fluid balance and electrolyte balance and describe their effects.

A cell undergoing meiosis produces a daughter cell during

A cell undergoing meiosis produces a daughter cell, during which one nondisjunction event occurs. If the number of chromosomes in a normal diploid cell of this organism (not undergoing cell division) is 38, how many chro ...

Case study 20 food for a low-income familysarah is a

Case Study 20: Food for a Low-Income Family Sarah is a 30-year-old mother of two young children, ages 3 and 5. Her husband was recently disabled in a car accident and has been unable to work for 6 months. Sarah works par ...

Which type of reproduction occurs through the formation of

Which type of reproduction occurs through the formation of different types of spores in favourable and unfavourable conditions by division of the protoplast

Schedule slippage and delays are common for project

Schedule slippage and delays are common for project managers to manage. Experience contributes to a project manager's ability to address schedule impacts. Discuss how organizations can utilize the Learning Theory and Pro ...

Identifynbspan organism that lives within 50 miles of your

Identify  an organism that lives within 50 miles of your home.  I live in Panama City, Florida 32405 I would like to use the wolf please? Write  a 1,050- to 1,400-word paper about how the organism has adapted to survive ...

Environmental science final projectcreate hour to hour and

Environmental Science Final Project Create hour to hour and half long POWER POINT lecture (20-25 slides) using the following topics: Human Population Dynamics, Recent Climate Change, Ozone in the Atmosphere and they Hyrd ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen