Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

What did the experiments by stanley miller demonstrate

What did the experiments by Stanley Miller demonstrate about the formation of the first organic molecules? Why was it significant?

You have been in hr for 8 years three weeks ago you joined

You have been in HR for 8 years. Three weeks ago you joined your third employer, Chicken Pluckers, Inc., as HR Manager. Chicken Pluckers is a family-owned, meat processing plant with 400 employees. Your new boss, the CEO ...

Which part of the human brain is the centre of memory

Which part of the human brain is the centre of memory, learning, thinking and reasoning?

What is produced by inflation of the apex of the

What is produced by inflation of the apex of the conidospore and later the inflated apex is separated by a septum?

Imagine that you had 11000 of the worlds gross domestic

Imagine that you had 1/1000 of the worlds gross domestic product available at your disposal for conservation biology product? Is it a sound conservation decision to protect just 4% of the earth's living habitat? Why or w ...

Do you think there are political issues surrounding human

Do you think there are political issues surrounding human population growth? Why or why not? Can you give an example?

1 what is the scientific basis behind evolution please

1. What is the scientific basis behind evolution? Please explain your answer

A multicellular lifeform has a weird type of cell in its

A multicellular lifeform has a weird type of cell in its body. This cell has a high density of peroxisomes. What is the most reasonable function of this cell? Functions for redox reactions Functions for digestion Functio ...

Question 1 an example of a community isone giant individual

Question 1 An example of a community is one giant individual kelp. a kelp forest plus all of the physical factors affecting it. all physical factors affecting a kelp forest. a kelp forest plus all organisms living in it. ...

A photon of ultraviolet light hits double-stranded dna and

A photon of ultraviolet light hits double-stranded DNA and creates a covalent cross-link between adjacent thymines in the same strand (a thymine dimer). What is likely to happen? a-The DNA strand with the thymine dimer w ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro

Describe what you learned about the impact of economic

Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environmen