Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

Microevolution is in some ways random while in other ways

Microevolution is in some ways random, while in other ways it is not. Explain what does this mean in regards to the potential of a mutation saving a species facing extinction?

Huntingtons disease affects individuals late into adulthood

Huntington's disease affects individuals late into adulthood. Given what you know about how Natural Selection works, explain why Huntington's disease hasn't been eradicated from the population.

Describe the purpose of the human genome project and how it

Describe the purpose of the Human Genome project and how it was achieved. Form a hypothesis of future research that could benefit from the HGP.

The effect of low ph on enzyme activitydesign an experiment

The Effect of low pH on Enzyme Activity Design an experiment in which you will test the effect of an acidic fluid on enzymatic activity. (Recall: enzymes are proteins.) To complete this project, it may be useful for you ...

The lac operator binds the lac repressor the dna sequence

The lac operator binds the lac repressor. The DNA sequence of the lac operator shares a characteristic with the DNA sequences of the binding sites of many restriction enzymes. What is this common characteristic?

What did the experiments by stanley miller demonstrate

What did the experiments by Stanley Miller demonstrate about the formation of the first organic molecules? Why was it significant?

Some boxers and wrestlers dehydrate abruptly by spending

Some boxers and wrestlers dehydrate abruptly by spending time in a sauna and sweating a lot in order to lose weight and compete with a lower tier, however this is a serious health hazard, explain what happens to the toni ...

What is normally presented on the mhc i complex of antigen

What is normally presented on the MHC I complex of Antigen presenting cells? When does it present foreign peptide on its MHC I complex? Can they present self peptides on their MHC I complex, but foreign peptides on their ...

Which phylloclade commonly found in xerophytic plants that

Which phylloclade commonly found in xerophytic plants that is modified?

Digestion is an important process in the human bodya

Digestion is an important process in the human body. a) Identify and describe the digestive processes. b) Consider the mouth, stomach, small intestines and large intestines - identify the digestive enzymes that are prese ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro