Ask Question, Ask an Expert

+1-415-315-9853

info@mywordsolution.com

Ask Biology Expert

By using the DNA sequence 3' ACTACGGCAATACGGGCTGGATCTGG 5', answer the given problems.

a) prepare down the mRNA sequence.

b) prepare down the sequence of the start codon.

c) prepare down the sequence of the stop codon.

Biology, Academics

  • Category:- Biology
  • Reference No.:- M937666

Have any Question? 


Related Questions in Biology

Bioethics assignment instructionstopic 2 use of gmo

Bioethics assignment instructions: Topic 2: Use of GMO mosquitoes to eradicate zika virus carrying mosquitoes Now you need to research the topic and write a 500-1000 word (1 to 2 pages) writeup about the topic. Please us ...

Discuss the three ways in which textiles can be recycled

Discuss the three ways in which textiles can be recycled. Why is it preferable to reuse rather than recycle textiles? Discuss the strategies that municipalities can use to more effectively deal with household hazardous w ...

Ephedrine is a drug which stimulates the sympathetic

Ephedrine is a drug which stimulates the sympathetic nervous system by mimicking epinephrine with subsequent stimulation of the production of cAMP by adenylyl cyclase. Why is the presence of cAMP prolonged when ephedrine ...

Antimicrobial resistance and natural selectionthe use of

Antimicrobial Resistance and Natural Selection: The use of antimicrobial drugs began during the World War II era. After more than 50 years of widespread use, many antimicrobial drugs have become ineffective. Health autho ...

Select one chronic illness that could be diagnosed early in

Select one chronic illness that could be diagnosed early in life, such as asthma, diabetes, or rheumatoid arthritis. Follow a person with this chronic illness through the lifespan, discussing how treatment approaches wou ...

Why is it not possible for hiv medications to eliminate hiv

Why is it not possible for HIV medications to eliminate HIV in a confirmed HIV-positive patient?

Discuss the mechanisms by which the lactoselac operon

Discuss the mechanisms by which the lactose(lac) operon functions in medium with an excess of lactose and a medium with lactose excess and glucose. Give 10 points

Wellnessevaluate your own neighborhood and surrounding city

Wellness Evaluate your own neighborhood and surrounding city with regard to environmental factors related to wellness and connect your findings to the eight dimensions of wellesnn. Discuss as many environmental factors a ...

Digestion is an important process in the human bodya

Digestion is an important process in the human body. a) Identify and describe the digestive processes. b) Consider the mouth, stomach, small intestines and large intestines - identify the digestive enzymes that are prese ...

1 to study the process of dna replication you add the

1. To study the process of DNA replication, you add the nitrogen isotope N-15 in a culture in which cells are growing. After one cell division, you analyze the DNA and find all the DNA has some N15 in it. You then grow t ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

WalMart Identification of theory and critical discussion

Drawing on the prescribed text and/or relevant academic literature, produce a paper which discusses the nature of group

Section onea in an atwood machine suppose two objects of

SECTION ONE (a) In an Atwood Machine, suppose two objects of unequal mass are hung vertically over a frictionless

Part 1you work in hr for a company that operates a factory

Part 1: You work in HR for a company that operates a factory manufacturing fiberglass. There are several hundred empl

Details on advanced accounting paperthis paper is intended

DETAILS ON ADVANCED ACCOUNTING PAPER This paper is intended for students to apply the theoretical knowledge around ac

Create a provider database and related reports and queries

Create a provider database and related reports and queries to capture contact information for potential PC component pro