Below is a segment of bacterial lac operon sequence. an e., Ask an Expert

Academics

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5' AUGU3'. Carefully examine the sequence and then answer the questions.
Strand A: 5'GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3'
Strand B: 3'CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5'
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5' aUUGU3'. include polarity of the transcript.

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M9366480

Have any Question?Write your Review or question?

Related Questions in Biology

Why were there no large mammals around when the dinosaurs

Why were there no large mammals around when the dinosaurs occupied the land?

Why soap changes the surface tension of waterand why adding

Why soap changes the surface tension of water? And why adding water into penny, the average of water drops in 90oC temperature water is less than average of water drops in room temperature

Two true-breeding stocks of pea plants are crossed one

Two true-breeding stocks of pea plants are crossed. One parents has red, axial flowers and the other has white terminal flowers; all F1 individuals have red, axial flowers. The genes for flower color and location assort ...

In summer squash white fruit w is dominant over yellow

In summer squash, white fruit (W) is dominant over yellow fruit (w) and the "disk" fruit shape (D) is dominant over "sphere" shape (d). Determine the genotypes of the parents in the following cases: A. White disk crossed ...

Question dietary recommendation and analysis projectin this

Question: Dietary recommendation and analysis project In this project, you will use software to analyze our own diet and make dietary recommendation. You will need submit a report. You can choose any of software if you f ...

Experiment 1 staining video1 open the media player by

Experiment 1: Staining Video 1. Open the Media Player by clicking on the film-strip button in the lower left of the lab's window frame, as shown below. The Media Player is a repository of images, videos, saved snapshots, ...

What types of molecular interactions occur between the

What types of molecular interactions occur between the active site and the substrate?

A mother has a blood the child has type o mr white has type

A mother has A blood, the child has type O, Mr. White has type B blood, and Mr. Green has AB. Whose the father? Mr. White or Mr. Green; Either Mr. White or Mr. Green; Neither Mr. White or Mr. Green could be the father an ...

A cross between a person with straight hair and a person

A cross between a person with straight hair and a person with curly hair will produce a child with wavy hair. If 2 people with wavy hair had a child, what are the odds that the child would have straight hair?

Is the iso-osmotic point different for different solutes

Is the iso-osmotic point different for different solutes? Please specify in what ways can the iso-osmotic points be different and why there is a difference.

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert