The sequence below is a section of the E. coli genome that encodes the pheM protein. Write out and label: A) the reverse complement, B) the mRNA sequence, and c) the resulting amino acid sequence using three letter code designations. Indicate what would happen if the underlined Thymine base is mutated to a Cytosine?
AGCAATGAATGCTGCTATTTTCCGCTTCTTTTTTTACTTTAGCACCTGAATCCAGG