Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Biology Expert

The sequence below is a section of the E. coli genome that encodes the pheM protein. Write out and label: A) the reverse complement, B) the mRNA sequence, and c) the resulting amino acid sequence using three letter code designations. Indicate what would happen if the underlined Thymine base is mutated to a Cytosine?
AGCAATGAATGCTGCTATTTTCCGCTTCTTTTTTTACTTTAGCACCTGAATCCAGG

Biology, Academics

  • Category:- Biology
  • Reference No.:- M9360138

Have any Question?


Related Questions in Biology

Two true-breeding stocks of pea plants are crossed one

Two true-breeding stocks of pea plants are crossed. One parents has red, axial flowers and the other has white terminal flowers; all F1 individuals have red, axial flowers. The genes for flower color and location assort ...

Calculate the concentrations at eqbm of h2co3 hco3- co32-

Calculate the concentrations at eqbm of H2CO3, HCO3-, CO32-, and H+ in a saturated aq solution of H2CO3 in which the original concentration of H2CO3 is 0.034M (Ka1= 4.3*10^-7, Ka2 = 4.8*10^-11)

Why were there no large mammals around when the dinosaurs

Why were there no large mammals around when the dinosaurs occupied the land?

Question - a pure strain of mendels peas dominant for all

Question - A pure strain of mendel's peas, dominant for all seven of his independently assorting genes, was testcrossed. How many different kinds of gametes could the F1 PRODUCE?

Question dietary recommendation and analysis projectin this

Question: Dietary recommendation and analysis project In this project, you will use software to analyze our own diet and make dietary recommendation. You will need submit a report. You can choose any of software if you f ...

Krebs cycletca cyclewhat are the reactantswhat are the

Krebs Cycle/TCA cycle What are the reactants? What are the products? What is the net ATP gain? Where does it take place in prokaryotes vs eukaryotes?

Discussion board 3 dnaafter reading the prompt below post

Discussion Board 3: DNA After reading the prompt below, post your answer using about 200 words. Post your initial response at least 24 hours prior to the assignment due date, then return to respond to another classmate's ...

Case study question -case study - mary 21 years old

Case Study Question - Case Study - Mary, 21 years old, presented to the hospital emergency department with an infected laceration on her left foot. Mary was at a beach resort four days ago, when she trod on a broken glas ...

Is this statement correct or incorrect whymuscle tension in

Is this statement correct or incorrect? Why? Muscle tension in cardiac contractile muscle can be increased by temporal summation.

A cross between a person with straight hair and a person

A cross between a person with straight hair and a person with curly hair will produce a child with wavy hair. If 2 people with wavy hair had a child, what are the odds that the child would have straight hair?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As