A double stranded dna molecule with the sequence shown here, Ask an Expert

Academics

Question: A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.

TACATGATCATTTCACGGAATTTCTAGCATGTA
ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT

a. Which strand of DNA is transcribed and in which direction?
b. Label the 5' and the 3' ends of each strand.
c. In an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be?

View complete question

Biology, Academics

Category:- Biology
Reference No.:- M9353741

Have any Question?Write your Review or question?

Related Questions in Biology

Case study question -case study - mary 21 years old

Case Study Question - Case Study - Mary, 21 years old, presented to the hospital emergency department with an infected laceration on her left foot. Mary was at a beach resort four days ago, when she trod on a broken glas ...

Assignment -the upper-case blue letters are the 14th exon

Assignment - The upper-case, blue letters are the 14th exon (of 20) in the Hephl1 gene in mice. The lower-case (black) letters are from the flanking introns. The highlighted bases indicate primers that may be used to ge ...

Question - a pure strain of mendels peas dominant for all

Question - A pure strain of mendel's peas, dominant for all seven of his independently assorting genes, was testcrossed. How many different kinds of gametes could the F1 PRODUCE?

Igfbp2 rbp4 and factor d post bariatric surgeryigfbp2 what

IGFBP2/ RBP4 and Factor D Post Bariatric Surgery IGFBP2 ( what the normal physiological action in the body? And how it affectedby obesity? andpost bariatric surgery?) RBP4 (what the normal physiological action in the bod ...

Assignment on nutrition - q1 task you need to select 2

Assignment on Nutrition - Q1. Task: You need to select 2 different age groups of your choice. You will need to plan balanced meals with snacks for a day. Once you have laid out the meal plan you need to: Explain why the ...

Question - gene cloning a please write the steps to clone

Question - Gene Cloning a) Please write the steps to clone the protease gene from Bacillus strain whose genome sequence is not known. b) Express the protease gene to obtain the enzyme in high yield, please plan your prot ...

Instructions address each question below as it relates to

Instructions: Address each question below as it relates to the caw study given. A patient was brought to the Emergency Department by ambulance with two arrow wounds. One arrow is still in the patient on the left side; en ...

Use of molecular tools and bioinforrnatics in the diagnosis

Use of Molecular Tools and Bioinforrnatics in the Diagnosis Characterization of Enteric Pathogens from a Case Study Purpose: The purpose of this project is to familiarize the student with modern molecular tools and bioin ...

Experiment 1 staining video1 open the media player by

Experiment 1: Staining Video 1. Open the Media Player by clicking on the film-strip button in the lower left of the lab's window frame, as shown below. The Media Player is a repository of images, videos, saved snapshots, ...

Chosen dr jan nolta- stem cell researcher head of uc davis

Chosen Dr. Jan Nolta- Stem Cell Researcher Head of UC Davis Stem Cell Program Director Topic Background: early Stem cells have the ability to develop into many different types of cells. Stem Cell Research is not without ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Biology Expert