1. Heparin is a polyanion that inhibits RNA transcription in vitro by binding directly to bacterial RNA polymerase (RNAP). If heparin interferes with the ability of the polymerase to bind DNA in a non-specific fashion, what subunit of RNAP is the heparin binding to?

2. The 5' end of the codon strand of a prokaryote gene is diagramed below.
+1
GACATAAACCCTTTGGGTTGACA(N)18GCTATAATGCCTCCAGTGGGA
I                                  II                                        III
GGAGGTGGAATGGAACCCGAG
IV

a. Which region(s) would most likely be protected from digestion by Dnase in the presence of the RNAP holoenzyme?

b. What would be the sequence of the 5' end of the encoded mRNA?

c. Upon transcription of this DNA, which region would contain the first codon to be translated?

3. A mutant of E.coli has constitutive expression of beta-galactosidase. A partial diploid formed with this mutant and F' I^+ O^+ Z^+ has normal, inducible synthesis of beta-galactosidase. What is the genotype of the mutant?

4. A mutant of E.coli cannot synthesis beta-galactosidase or beta-galactosidase permease in the presence or absence of lactose. A partial diploid formed with this mutant and F' I^+ O^c Z^+ Y^+ also cannot be induced to synthesize either enzyme. What possible genotypes could the mutant have?