1. Using the figure below, which of the cells is gram positive and which is gram negative?  How do you know?

2. Using the figure above, what other phenotypes can you use to characterize the sample on the right?  

3. You have used a compound microscope to observe your cells.  What is the total magnification of an image if it was viewed using a 10X ocular lens and a 40X objective lens?

4. Next week, you will extract DNA from your chosen microbe.  Read the protocol carefully.  Step 12 instructs you to add isopropanol, and then centrifuge.  After centrifuging the tube, where is the DNA  in the supernatant or in the pellet)?  Why?  

5. Once you have purified your DNA, you will perform PCR.  Answer each of the following questions:

a. You will be amplifying the 16S rDNA locus.  What are two features of this locus that make it valuable for identifying an uncultureable microbe? 

b. If your DNA is at a concentration of 48 ng/ul and you wish to add 100ng of template to your PCR reaction, how many microliters of DNA will you add? 

c. If your initial sample contains 3 copies of the 16S rDNA region, how many copies will there be after 30 PCR cycles? 

6. On day 3, you will perform an agarose gel.  You will load a portion of your PCR reaction on the gel. 

a. How many bands do you expect to see per lane? 

b. What size do you expect the band s) will be? 

7. On Day 4, you will obtain your sequence. An old technology would run chain-terminated products on a polyacrylamide gel to identify the fragments.  On the figure below, draw the gel that would result from the following template sequence make sure to pay attention to the 5' and 3' ends.  Remember how DNA synthesis works!):

3' - ATGGCTGAGGTCTGAAATGTC - 5'