1. The following series of nucleotide bases forms part of a DNA molecule: TACTTATGACACAGGAGGACT

(a) Convert this string of bases into the bases that would be found on the corresponding mRNA molecule (transcription).

(b) Convert your answer from (a) into codons, and then list the string of amino acids that they code for (translation).

(c) Suppose that the 4^th "T" on the original DNA sequence (underlined) is changed to a "G" by a point mutation. How is the resulting string of amino acids changed?

(d) Suppose that the last "G" on the original DNA sequence (underlined) is changed to a "C" by a point mutation. How is the resulting string of amino acids changed?

(e) Suppose that an extra "C" is inserted into the original DNA sequence after the 1^st "C" (underlined). How is the resulting string of amino acids changed?

(f) Suppose that the 3^1d "A" on the original DNA sequence (underlined) is deleted. How is the resulting string of amino acids changed?

(g) Why are frameshift mutations (insertions and deletions) more likely to produce changes in an organism than a point mutation?