+61-413 786 465
info@mywordsolution.com
Home >> Chemistry
Given the following DNA template (non-coding) sequence:
3' - CCGTCTCCATCATGTTGTACATGCGGGCGCTGTGCGCGGGCCCGGCCCG - 5'
a) Provide the corresponding mRNA sequence and label the 5' and 3' ends:
b) What are the first 3 amino acids coded by this gene?
Chemistry, Academics
Priced at $20 Now at $10, Verified Solution
What is the calculation of the new temperature of a gas sample has an original volume of 740 ml when collected at 710 mm and 35 o C when the volume becomes 460 ml at 1.20 atm?
Q1: In your gravimatric analysis experiment, you weigh the precipitate of AgCl in a filtering crucible. You have to weight your filtering crucible first (three weighing measurement), then do the filtration. After drying ...
The combustion of naphthalene (C 10 H 8 ), which releases 5150.1 kJ/mol, is often used to calibrate calorimeters. A 1.05 - g sample of naphthalene is burned in a calorimeter, producting a temperature rise of 3.86 degrees ...
A paint contains 180.0 ppm lead. Approximately what mass of lead will be in 1.00 cm ^3 of this paint when 1.00 gal is uniformly applied to 445.0 ft 2 of a wall. The density of the paint is 8.00 lb/gal.
When .514g of biphenyl (C12H10) undergoes combustion in a bomb calorimeter, the temperature rises from 25.8 degrees C to 29.4 degrees C. Find delta E(rxn) for the combustion of biphenylin kJ/mol. The heat capacity of the ...
Match the reaction provided on the left with the correct reaction classification/type on the right [NOTE the reaction equations are not balanced] . Reaction classification/types can be used more than once or not at al ...
What is the chemical name for S6O and what is the chemical name for S7O2?
A 42.60 gram sample of a hydrate of BaI 2 was heated thoroughly in a porcelain crucible, until its weight remained constant. After heating, 39.01 grams of the dehydrated compound remained. What is the formula of th ...
What is the calculation of K c for the following reaction if an initial reaction mixture of 0.600 mole of CO and 1.80 mole of H 2 in a 6.00 liter container forms an equilibrium mixture containing 0.226 mole of H 2 O an ...
Sodium sulfide (11.7 g) reacts with hydrochloric acid (16.7 ml, 12.0 M) to yield sodium chloride and hydrogen sulfide. What is the theoretical yield (g) of hydrogen sulfide?
Start excelling in your Courses, Get help with Assignment Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.
Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate
Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p
Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As
Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int
Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As