Thread the sequence, Ask an Expert

Engineering

Assume we encode A, T, C, and G as two bit codes A:00, T:01, C:10, and G:11, respectively. Given the sequence AATCGATAAGCAAAACCGGA, build a hash table with all possible 3-mers from this sequence.
Problem 2. Given the patterns listed below:
P1=ATCGAT, P2=CGATAT, P3=AAGCAA, P4=CCGCAT, and P5=ATCCAT.
1) Build a keyword tree based on these patterns;
2) Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

View complete question

Computer Engineering, Engineering

Category:- Computer Engineering
Reference No.:- M9638524

Have any Question?Write your Review or question?

Related Questions in Computer Engineering

If we take infinite samples of size n 49 from a population

If we take infinite samples of size n = 49 from a population with a distribution with high kurtosis and standard deviation 7, select the best answer below. * The sampling distribution of the sample means will have a stan ...

String c is considered to be an interleaving of strings a

String C is considered to be an interleaving of strings A and B if it contains all (and only) the characters of both A and of B and their respective order is preserved in C. For example, C = aacabbaa is an interleaving o ...

A student is curious about how a web site appears on his

A student is curious about how a Web site appears on his computer screen. Draw and explain the communication between a client and a server when the client requests a Web page; use the OSI model as a reference. For exampl ...

Suppose a coworker approaches you and asks what an ethical

Suppose a coworker approaches you and asks what an ethical hacker does. She does not understand the role that an ethical hacker plays in the security industry and assumes that such a hacker intentionally causes damage. E ...

What is the role of arp and how does it cause a security

What is the role of ARP and how does it cause a security concern? What is the different between global and private IP addresses? How does using NAT change a private IP address into a global IP address, and why is this so ...

What are content management systems cms describe the

What are Content Management Systems (CMS). Describe the challenges in implementing and maintaining CMS. Can internet search engines be considered as Content Management Systems - explain your answer.

A string in c is simply an array of characters with the

A string in C++ is simply an array of characters with the null character(\0) used to mark the end of the string. C++ provides a set of string handling function in as well as I/O functions in . With the addition of the ST ...

A company is considering producing a new product based on

A company is considering producing a new product. Based on past records, management believes that there is a 70 percent chance that the new product will be successful, and a 30 percent chance it will not be successful. M ...

1 potassium metal is very reactive with liquid bromine the

1. Potassium metal is very reactive with liquid bromine. The result of the reaction is the formation of a white ionic solid. Explain what happens to these elements when they form an ionic compound and write the formula f ...

A researcher conducts a well-designed study to compare a

A researcher conducts a well-designed study to compare a sample mean to a known population mean and uses alpha=.05, two-tailed. She finds a z-test of 1.98, p-value=.048. What should she conclude? a. The 95% confidence in ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Computer Engineering Expert