Question suppose we are interested in studying a dna, Ask an Expert

Engineering

Question :

Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T.

Write a program that does the following: Create a random DNA string of length 50.

Determine how many times A occurs in the DNA string. Create a dot string which blanks out everything but all the A characters.

Create a rep string where everything is blanked out except where A repeats 1 or more times. Prints the results as follows:

DNA: TGAAAACTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA

dotStr:.. AAAA. .A..A.A. .A...A...... AAA.AA.AAA.....A..A.AAA

repStr:. AAAA.....................AAA.AA.AAA.........AAA

#A: 22

View complete question

Computer Engineering, Engineering

Category:- Computer Engineering
Reference No.:- M93129505

Have any Question?Write your Review or question?

Related Questions in Computer Engineering

Across the nine cities in multilevel multivariate analysis

Across the nine cities, in multilevel, multivariate analysis, controlling for income inequality (GINI coefficient), percent living in poverty and percent Non-Hispanic Black population, the ZIP code level overall HIV diag ...

Suppose we have a magnetic disk with the following

Suppose we have a magnetic disk with the following parameters: • Average seek time = 8 ms • Rotation rate = 7200 RPM • Transfer rate = 150 MB/second • Sector size = 512 bytes. What is the average time to read a single se ...

Do you need computers or information and communication

Do you need computers or information and communication technologies to store, organize, and manage data in organizations? Explain how the present day organizations in a developed country like the USA store and manage the ...

Question sms imessage and whatsapp are all smartphone

Question : SMS, iMessage, and WhatsApp are all smartphone real-time messaging systems. After doing some research on the Internet, for each of these systems write one paragraph about the protocols they use. Then write a p ...

What is the syntax to accomplish the following tasksdisplay

What is the syntax to accomplish the following tasks? Display the value of element of string array myStringArray with index 5 Initialize each of the ten elements of one-dimensional integer array myIntArray to 10 Total al ...

In mergers and acquisitions there is always a

In mergers and acquisitions there is always a pre-acquisition evaluation and post-acquisition evaluation of technology. Evaluation and control should be connected to each other. What should you know before and after the ...

Scenarioyour friend tim hall is an expert in creating

Scenario Your friend, Tim Hall, is an expert in creating websites. In Hall's opinion, creation of websites is now a simple task using tools such as Adobe Dreamweaver, and therefore, he does not feel the need to learn HTM ...

We might consider a regression of the number of group

We might consider a regression of the number of group members and the efficiency of project completion. Which of those would be the dependent and which would be the independent variables?

Question you need to research the topic and discuss the

Question: You need to research the topic and discuss the topic in at least 400-500 words with references. A post without a reference will not count as a discussion. What is text mining and what is the purpose of it? Give ...

Question suppose you have created a program that creates

Question : Suppose you have created a program that creates instances of different types of cars. Now you are creating a program that keeps track of different types of cars. Choose the abstract classes and concrete classe ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Computer Engineering Expert