Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

You will be writing ONCE and ONLY ONCE about each of the following behaviors: Aggression, Being Organized, and Smoking.

For each behavior, you must apply ONE of the theoretical perspectives to explain how that behavior may have been acquired. You must use each theory once, and only once.

For example, if you use Biological Theory to explain ‘Aggression', you may NOT use Biological Theory for either ‘Being Organized' or ‘Smoking.' You only need to write a brief description (probably around 3 sentences or less!) for each.

Question1: What theory will you be applying first (Biological, Learning, or Psychoanalytic)? If you selected Learning Theory, you MUST ALSO state whether you will be describing Classical Conditioning, Operant Conditioning, or Social Learning.

Question2: Please use that theory to explain how one of the behaviors (Aggression, Being Organized, or Smoking) may have been acquired (Three sentences or so!)

Question3: What theory will you be applying first (Biological, Learning, or Psychoanalytic)? If you selected Learning Theory, you MUST ALSO state whether you will be describing Classical Conditioning, Operant Conditioning, or Social Learning.

Question4: Please use that theory to explain how one of the behaviors (Aggression, Being Organized, or Smoking) may have been acquired (Three sentences or so!)

Question5: What theory will you be applying first (Biological, Learning, or Psychoanalytic)? If you selected Learning Theory, you MUST ALSO state whether you will be describing Classical Conditioning, Operant Conditioning, or Social Learning.

Question6: Please use that theory to explain how one of the behaviors (Aggression, Being Organized, or Smoking) may have been acquired (Three sentences or so!)

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92526780
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

In this third week we are discussing the human

In this third week, we are discussing the human socialization process and how it influences our psychosocial development. After you have read the reading assignment and lecture for the week, please respond to all parts o ...

Edmund burke viewed society as the source of moral growth

Edmund Burke viewed society as the source of moral growth across generations and across members; an organic and enduring social fabric. Accordingly, the relationships between people within a society are essential. After ...

Question culture clearly has strong effects on mental

Question: Culture clearly has strong effects on mental disorders. How does this influence what you think about what is normal or abnormal? The German Philosopher Friedrich Nietzsche thought that society itself might be n ...

Biotechnologybased on research on the following dot points

Biotechnology Based on research on the following dot points - Applications of Biotechnology. Outline one way that forensic scientists can use DNA analysis to help solve cases How police find out DNA Identify data sources ...

Capstone in criminal justice final project -overview -as

Capstone in Criminal Justice Final Project - Overview - As the final stop in your journey toward your Bachelor of Science in Criminal Justice, you will complete a capstone that integrates the knowledge and skills you hav ...

Assignment 1 internet of things devicesbullconsider the

Assignment 1: Internet of Things Devices • Consider the various types of mobile and Internet of Things (IoT) devices. What are the common risks associated with them? • Based on what you have learned this week, would you ...

Assignment 2 critical thinking essaythe purpose of this

Assignment 2: Critical Thinking Essay The purpose of this assignment is to demonstrate your theoretical understanding of the stress and it's impact on an athlete. Read Critical Thinking Question Number 1 on pg.76 of your ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1 define and explain in your own words maslows

Question ; 1. Define and explain in your own words, Maslow's theory of love. Use examples! (hint: this comes from his "hierarchy of needs") 2. Define and explain Reiss's Wheel of love. ALL the stages. Use examples! (i.e. ...

Question submit a powerpoint presentation based on four

Question: Submit a PowerPoint Presentation based on four different conflicts you have encountered. These conflicts can be work related or personal conflicts. The presentation will consist of 5 slides and must have at lea ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As