Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Health Records Management 

· Review record management issues that typically differentiate different sized facilities.
· Create record management guidelines for a new, medium-sized medical facility.

2. Final Project: Records Management Presentation 

You have been hired as the records manager for Happy Health Medical Clinic, a medium-sized, general practice about to start up business. Whereas this medical facility hopes to have everything computerized at some point in the future, that is not currently the case. Therefore basic patient information is located on the computer, but medical information is only found in paper files. Your facility stores, circulates and updates patient records internally for six doctors, and traffics them up one floor to an X-ray department-in other words, you loan records, but you do not borrow them. Because the X-ray facility is in partnership with Happy Health, you send actual patient files up to X-ray, not copies, and it is important to get the files back. 

Resource: Appendix A, Materials Forum 

Due Date: Day 7 [Individual forum] 

Create a 12-to-15-slide PowerPoint® presentation outlining standard records management procedures for the employees who work for Happy Health Medical Clinic. Your presentation should include:
o Introduction and conclusion slides, 
o Detailed speaker's notes. The speaker's notes must describe the bulleted items on the slide and provide rationale for policy decisions. Include one or more complete paragraph of speaker's notes per slide. 
o Cite outside references used, if any, according to APA format. 

Include the following information in your presentation: 
? The importance of getting new information into a patient's record as timely as possible 
? Not duplicating medical records for the same person 
? How to know at all times where a record is located as you write practical, how-to procedures to cover the following aspects of records management: 
? Indexes for administering health care information 
? Centralized or decentralized records management 
? Creation of new records-record format 
? Type of filing system: 
Basic rules of the system 
Examples to clarify names or numbers that might be confusing in that system 
? Temporary and permanent insertion of loose forms and care reports: 
Handling clinical data that a doctor needs to see 
Handling administrative data that a doctor does not need to see 
? Storage for patient files: 
Short-term (patient returns in 2-3 days) 
Permanent (patient is not due back soon but is currently under care) 
Archive (patient record has not been used for some time) 
? Physical circulation of records within your facility, and between your facility & X-ray: 
Routing and tracking records within areas of your department & out to X-ray 
Storing lab reports that come in when a patient's file is at X-ray 
? Retention schedule-destruction of records 
? File security 
? Legal and ethical responsibilities 

Presentation Grading Form for Records Management Presentation, Due in Week Nine

Content and Development 210 Points Points EarnedXX/210
Additional Comments:
All key elements of the assignment are covered in a substantive way. The student describes: · Indexes for administering health care information· Centralized or decentralized records management· Creation of new records-record format· Type of filing systemo Basic rules of the systemo Examples to clarify names or numbers that might be confusing in that system· Temporary and permanent insertion of loose forms and care reports o Handling clinical data that a doctor needs to seeo Handling administrative data that a doctor does not need to see · Storage for patient files:o Short-term (patient will return in 2-3 days)o Permanent (patient is not due back soon but is currently under care)o Archive (patient record has not been used for some time)· The physical circulation of records within the facility, and between the facility and X-rayo Routing and tracking records within areas of the department and out to X-rayo Storing lab reports that come in when a patient's file is at X-ray · Retention schedule-destruction of records· File security· Legal and ethical responsibilities · Presentation consists of 12 to 15 slides appropriate for the speaker's audience.
The content is comprehensive, accurate, and persuasive.· Presentation includes visual aids and utilizes elegant graphics.· Text is limited to approximately five lines per slide, approximately five words per bulleted item.· Appropriate font sizes are used.· Detailed speaker's notes explain bulleted items and rationale behind policy decisions.· The presentation includes at least one complete paragraph of detailed speaker's notes per content slide.
The presentation develops a central theme or idea directed toward the appropriate audience.
The presentation links theory to relevant examples of current experience and industry practice and uses the vocabulary of the theory correctly.
Major points are stated clearly; are supported by specific details, examples, or analysis; and are organized logically.
The introduction provides sufficient background on the topic and previews major points.
The conclusion is logical and reviews the major points.

Readability and Style 20 Points Points EarnedXX/20
Additional Comments:
Slide transitions are logical and maintain the flow throughout the presentation.
The tone is appropriate to the content and assignment. 
Sentences are clear and concise.

Mechanics 20 Points Points EarnedXX/20
Additional Comments:
Citations of original works within the body of the presentation follow APA standards.
The presentation is laid out with effective use of headings, font styles, and white space.
Rules of grammar, usage, and punctuation are followed.
Spelling is correct.

Total 250 Points Points EarnedXXX/250
each day i am late it is 10% pentlay i really needs this today. Sorry i found it online under economic, maybe this will help better to answer it. 

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9482024

Have any Question?


Related Questions in Homework Help/Study Tips

The national counter-terrorism center nctc was created

The National Counter-Terrorism Center (NCTC) was created based on the recommendation by the 9/11 Commission, in the wake of the terrorist attacks in September 2001, in an effort to eliminate duplication and create a more ...

Question ethical dilemmas may present themselves in

Question: Ethical dilemmas may present themselves in different ways when working with a forensic population. In this assignment, you will identify a scenario that presents an ethical dilemma and explain how you would res ...

Summary paper - comparing budget line itemslooking at our

Summary Paper - Comparing Budget Line Items Looking at our state budgets and how the funds are allocated to different entities can be very enlightening. Using the link below, you will find interesting information regardi ...

Question you have all heard the saying about how there are

Question: You have all heard the saying about how there are only two things in life that you must do: die and pay taxes. So far, no one has discovered a cure for death nor developed a way to finance government without ta ...

Comment 1 mucor is a mold that causes a serious fungal

Comment 1: Mucor is a mold that causes a serious fungal infection. Mucormycosis most commonly affects the sinuses or lungs and affects people with weakened immune systems. It infects the sinuses or lungs after inhaling f ...

1 written report - annotated bibliographythis is the major

1. Written Report - Annotated Bibliography This is the major piece of work for this course and as such, should satisfy the following criteria: - A company should an Australian company. - Demonstrate understanding of the ...

Consider the following two scenariosscenario 1employees

Consider the following two scenarios: Scenario 1 Employees work in an atmosphere of distrust and fear. Leaders make decisions behind closed doors. Changes to processes and staffing often occur unexpectedly without warnin ...

Instructionsin this assignment you will be using a weighted

Instructions: In this assignment, you will be using a weighted decision model (also known as a weighted matrix) to help a company select a new CRM system. Use the information given below and construct a weighted matrix m ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question what do you see as the primary difference between

Question: What do you see as the primary difference between operating exposure and translation exposure? Would this have the same meaning to a private firm as a publicly traded firm? Why or why not? Your initial post mus ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As