Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

You are a substance abuse counselor. Gregory, your new client, has come to you for help with his alcohol use problem. Gregory is married with three children and works as a sales representative for a large corporation in the city. In your first meeting with Gregory, you discover that his drinking began as a way to alleviate the anxiety he felt in social situations. Over time, Gregory began using alcohol more often. He found that every time he used alcohol, his anxiety lifted and he was able to be more at ease during work, out with colleagues, and at other such public events. Over time, Gregory realized he needed more alcohol than before to get the same anxiety relieving effects.Two weeks ago, one of Gregory's coworkers became suspicious that Gregory was drinking at work. That same day, while Gregory was driving home from work, he was pulled over by the police. He passed the field sobriety test and the officer let him off with a warning. These two events served as a wake-up call for Gregory as he realized his alcohol use may be beyond his control.Gregory has made an appointment with you because he sincerely wants to curtail his alcohol use.

To help Gregory achieve his goals, write a paper that analyzes the components of his scenario. In your paper, ensure that you include the following information:Summarize the history and usefulness of the four major contemporary treatment modalities (crisis intervention, individual counseling, group counseling, and family counseling).Evaluate Gregory's dual diagnosis (also referred to as "co-occurring disorders") and the implications for counseling. Keep the following questions in mind: Describe the meaning of dual diagnosis and how it impacts counseling.Classify Gregory's primary and secondary diagnoses.Analyze the implications in treating a secondary diagnosis.Evaluate the limitations for an alcohol and drug counselor when treating diagnoses other than those related to substance abuse. Describe the circumstances where the four treatment modalities might be useful in a dual diagnosis. Recommend at least one treatment modality for Gregory and explain your recommendation using at least two scholarly references.Write a 4-5-page paper in Word format. Use scholarly resources, including your textbook, to support your ideas. Your paper must be in Word format and include a title page and reference page in addition to the 4-5-pages of content. Apply APA 6th edition standards to the format of the paper, and the citation of sources

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92499312

Have any Question?


Related Questions in Homework Help/Study Tips

Question describe best practices for the communication of

Question: Describe best practices for the communication of changes to total rewards programs. The response must be typed, single spaced, must be in times new roman font (size 12) and must follow the APA format.

The assignments allow for a fun take on the concepts

The assignments allow for a fun take on the concepts reviewed in this course. Videos snippets from popular television programs and movies will be viewed and students will post a response to the videos based on the course ...

Assignment descriptioncreate a strategy memo for

Assignment Description Create a strategy memo for communicating and educating the citizens of the community that you identified in the previous week about their risk portfolio. Assignment Guidelines • Address the followi ...

Question 1discuss two or three strategies you can utilize

Question: 1. Discuss two or three strategies you can utilize when writing or speaking to persuade others to accept your point of view. 2. Explain the value of knowing your audience when preparing a presentation. 3. Discu ...

Question resources in healthcare simulationswhat main

Question: Resources in Healthcare Simulations What main resources would you need to integrate an academic electronic health record in healthcare simulations (with and without human patient simulators)? Include staff in t ...

Assignment details scenarioyou have successfully graduated

Assignment Details Scenario: You have successfully graduated from college and are offered a leadership role at a prison. What leadership style will you use in your position? Why do you think it would work best for you? C ...

Your highest performing and tenured manager of a 20 person

Your highest performing and tenured manager of a 20 person department unexpectedly submitted their two weeks' notice. Your next most tenured employee in the department has only 2 years of experience. Additionally, there ...

Assignment 3 recognizing and projecting trends in io

Assignment 3: Recognizing and Projecting Trends in I/O Psychology Consider the trends discussed in the required readings for this module along with relevant learning from your courses throughout the MAIO program. Further ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Required - please write a solution to the case studyjohnny

REQUIRED - Please write a solution to the case study: Johnny has been training a new chef, Rupali, in the kitchen of his restaurant. Johnny thinks Rupali is almost ready to prepare food for customers. Johnny and Rupali a ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As