Write down the differences between omniscient and, Ask an Expert

Others

1. Write down the difference between narration and narrator? Explain the narration in the film Rocky.

2. Write down the differences between omniscient and restricted narration? Which more accurately explains the narration of Rocky?

3. Can the major character be flat? Can minor character be round? Describe your answer by giving examples from either Rocky or another movie.

4. What is the climax, and how does it associate to protagonist's pursuit of goal? What scene represented climax of Rocky? Why?

5. Write down the difference between suspense and surprise? Which one is more difficult for filmmaker to create? Why?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M9358531

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Quesiton detailspart 1 using the revised treatment plan

Quesiton: Details: Part 1: Using the revised treatment plan completed in Topic 7, complete a discharge summary for your client using the "Discharge Summary" template. This discharge summary should address the following: ...

Discussionmiddot what type of murder did anakin commit in

Discussion · What type of murder did Anakin commit in "killing" his wife? · In some cases, one can build an argument that Anakin is a terrorist. How can you justify this statement using the types/forms of terrorists desc ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question conduct research on the current state of social

Question: Conduct research on the current state of Social Security. Based on your research, write a three-to-five page paper (not including the title and reference pages). Your paper should be written in a scholarly thir ...

Corporate ethics have been the focus of increased attention

Corporate ethics have been the focus of increased attention in recent years. Many companies have looked to their HR team to develop a comprehensive ethics policy. You are tasked with developing an ethics policy for a jew ...

Case brief 71 in re yukos oil company securities

CASE BRIEF 7.1 : In re Yukos Oil Company Securities Litigation 2006 WL 3026024 (S.D.N.Y.) Questions: 1. Describe how Yukos is alleged to have saved significant amounts in taxes. 2. Explain what act of the Russian Federat ...

Question mental health consultationprior to beginning work

Question: Mental Health Consultation Prior to beginning work on this assignment, it is recommended that you read Chapter 1 in Turning Points in Dynamic Psychotherapy: Initial Assessment, Boundaries, Money, Disruptions an ...

Mario gonzalez 34 years old was just convicted on

Mario Gonzalez, 34 years old, was just convicted on misdemeanor sexual assault charges, for improperly fondling a child. This is Mario's first conviction for a criminal offense. His pre-sentence investigation report show ...

Question lesson 3 discussion forumdesigning team and team

Question: Lesson 3 Discussion Forum Designing Team and Team Identity Part 1: Think about how to build teams in terms of designing the task, selecting the people, and then, managing their relationships. How would compose ...

Question describe the interference of a god or goddess in

Question: Describe the interference of a god or goddess in influencing a particular choice facing a human character in Book I of The Iliad. By analyzing direct quotations of Homer's language, explain how the god or godde ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert