Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Write a seven hundred to one thousand word essay about a topic in which you argue for the existence of a particular phenomenon by stating a generalization about the topic. Then you will support that generalization (in the form of a thesis statement) by choosing to write a single-example illustration essay or a multiple-example illustration essay.

The purpose of this assignment is to measure your mastery of those conventions by putting your knowledge to practice. In a larger context, the purpose of writing an illustration essay is to convey an idea to the reader by providing illustrations (examples) that will solidify the existence of a topic.

Process: For the illustration essay, you will complete the following steps:

1. Choose a topic

2. Decide if you want to write a single-example or multiple-example essay: .

3. Collect illustrations.

4. Craft your thesis statement. Note that you want to craft your thesis according to whether you choose to write a single-example or a multiple-example essay.

5. Draft the essay: For each section of the essay ,the introduction, body paragraphs; and the conclusion.
Stylistic details: All essays must meet the following requirements:

  • seven hundred fifty to one thousand words.
  • Write in Tmes Nw Rman, 12 pt. font.
  • Include one-inch margins on all sides.
  • Use double spacing (top-to-bottom every page, to include above and below titles and centered words).
  • Include an APA ttle page (for all essays) and reference list that includes all of the sources used in the essay.
  • Include a header.
  • Include page numbers (upper-right corner only).
  • Adhere to APA convention and documentation style
  • At least one source is required. All sources used must be cited.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92398902
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question please do an internet search and find out the

Question: Please do an internet search and find out the results of the Erin Andrews invasion of privacy case that the Craig discusses in the assigned text. Write a commentary on your thoughts on the case. Need 300-350 wo ...

Your job in this assignment is to create two virtual

Your job in this assignment is to create two Virtual machines each running a different but the latest distribution of Linux e.g. Ubuntu Server and CentOS. Each of these VM's is to offer services to a user base. The Virtu ...

Question fallacies- iia fallacy is an error in reasoning or

Question: Fallacies- II A fallacy is an error in reasoning or thinking, sometimes called a "thinking error." We have learned about a few fallacies in thinking, but here are a few more. It is important to understand and s ...

Assignment -i deviant acts - want you to go out in your

Assignment - I. Deviant acts - Want you to go out in your community and be deviant in some NON CRIMINAL way. For example, wear your clothes on inside out, carry a teddy bear around and treat it like a real human infant o ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assignment - read the article and answers the

Assignment - Read the article and answers the questions. Article - Amazon Will Consider Opening Up to 3,000 Cashierless Stores by 2021 By Spencer Soper Questions - Question 1: Is there a future in retailing for this type ...

Question details note this is an individual assignment

Question: Details: Note: This is an individual assignment. Applying what you have learned thus far, develop a community teaching proposal designed to address the needs of your community. Select one of the following as th ...

Quesiton according to the american diabetes association

Quesiton: According to the American Diabetes Association (2011), 25.8 million children and adults have been diagnosed with diabetes in the United States. Approximately 2 million more are diagnosed every year, with anothe ...

Question needs and uses of long-term care please respond

Question: "Needs and Uses of Long-Term Care" Please respond to the following: • Determine two (2) current needs and two (2) current uses of long-term care services. • Determine the main way(s) the overall needs and uses ...

Question select a practice problem of interest to use as

Question: Select a practice problem of interest to use as the focus of your research. Start with the patient and identify the clinical problems or issues that arise from clinical care. Following the PICOT format, write a ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As