Would it be a good idea if the president congress and other, Ask an Expert

Others

Would it be a good idea if the president, Congress, and other governmental agencies could get the courts to rule on the constitutionality of proposed governmental actions before they were put in place? Wouldn't considerable time and trouble be saved if courts were allowed to nip unconstitutional acts in the bud before they did any harm? Defend your position.

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M9876866

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Quesiton van duzers big-picture thinking as delineated in

Quesiton: Van Duzer's big-picture thinking (as delineated in Why Business Matter to God) can be interpreted as follows: • Creation-God created all things good, including business; • Fall-all things have fallen from that ...

Question a critical analysis of the impact of health

Question: A critical analysis of the impact of health informatics on healthcare consumers. 1000 words, with full referencing Guidelines: • This is a compulsory formative assignment. It is designed to provide you with ear ...

Question determine the key distinctions between the plessy

Question: Determine the key distinctions between the Plessy v. Ferguson and Brown v. Board of Education rulings and the effects of segregation on public education. Also, propose one (1) challenge that might exist today r ...

Hipaa tutorial and reflectionthis assignment will introduce

HIPAA Tutorial and Reflection This assignment will introduce you to the Health Insurance Portability and Accountability Act (HIPAA). This act outlines ethical behaviors and responses for human service and health-related ...

Question compare and contrast the regions of the united

Question: Compare and contrast the regions of the United States on several factors such as economic development, race and ethnicity, political ideology, and religion, and explain how these factors may affect policy diffe ...

Question public health nursing involves working with

Question: Public health nursing involves working with communities and populations as equal partners, and focusing on primary prevention and health promotion (Kulbok, Thatcher, Park, Meszaros, 2012). There are many types ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question wechsler memory scales and the minnesota

Question: Wechsler Memory Scales and the Minnesota Multiphasic Personality Inventory test. In reference to the two types of assessments. How could the use of technology impact the administration of these assessments? Do ...

One of the outcomes of the introspective philosophies was

One of the outcomes of the introspective philosophies was the emergence of ideas that hastened the development of scientific tools used to explore the natural world. Physiology and psychophysics emerged. Choose one of th ...

Assignment instructionsbackground film consultants advise

Assignment Instructions Background: Film consultants advise filmmakers on how to correct historical inaccuracies in their scripts, props, and settings. In this assignment, you are tasked with identifying archaeological i ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert