Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

What effect does the media have on body image?

Final Draft Specifications Length: 1300-1500 words (not including citation page) Format: Please use APA citation style. (If you are majoring in English, email your instructor about using MLA instead.)

Your paper should include at least two visual elements (for example, charts, tables, diagrams, photographs, or screenshots) that have an informational/communicative function within the main text. Visual elements must be properly labeled and properly cited. (We will practice this in class.)

Audience: Address your paper to an academic audience, one that is college0educated and values analytic examination backed by persuasive evidence from expert sources. Ideas must be fully explained but also must approach an expert-level understanding of the topic.

Range of Research Sources: You must use a minimum of six high-quality/reliable sources, at least three of which must be peer-reviewed, scholarly journal articles from the NU library's databases. (Note: a minimum = barely passing.) Be assured that the NU Library skills you develop will be transferable to other academic research environments, as academic libraries are set up very similarly and draw upon the same database vendors: ProQuest, EBSCO, etc.

You should also try to use at least one book, but this will depend on your topic. Be aware of the "information cycle": events are generally covered first in newspapers, then in magazines, then in scholarly journals, and then in book-length studies. It's usually not possible to find books on very recent issues or events. Whenever you use web sites, you will need to be aware of the limitations and possible biases of such sources. This awareness should shape how you use various kinds of web sources in your paper. Your goal should be to draw upon credible sources in your paper, and to conduct a thorough and fair inquiry.

Cross-disciplinarity: The paper should also be cross-disciplinary. That is, it should draw upon data and insights from more than one academic discipline to shed light on the research question.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9746043

Have any Question?


Related Questions in Homework Help/Study Tips

Discussion - you are not a gadget1 do you agree or disagree

Discussion - You Are Not a Gadget 1. Do you agree or disagree with the central thesis of this book? Explain. (Minimum 100 words) 2. In your opinion how has the "standardized presences on Facebook", or in any other form o ...

Assignment 3 essay coping with adversitypart i imagine that

Assignment 3: Essay: Coping with Adversity Part I: Imagine that you are an athlete in a sport of your choice who is mired in a prolonged performance slump. Treating your slump as a type of adversity, create a hypothetica ...

Question you have an idea to improve patient care that you

Question: You have an idea to improve patient care that you would like upper management to support and fund. What type of communication tool would you use to present your idea and why? The response must be typed, single ...

Question increased demand for health care services leads to

Question: Increased demand for health care services leads to an increasing need for health care organizations to be cost efficient. What are the factors that impact an organization's financial viability? The response mus ...

Question primary task response within the discussion board

Question: Primary Task Response: Within the Discussion Board area, write 400-600 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions w ...

Describe the origin of transformational leadershipdiscuss

Describe the origin of transformational leadership. Discuss the criticisms, or weaknesses, of transformational leadership theory. Analyze the role of transformational leadership in student success. Case Assignment Use th ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Ms marlon is a new high school teacher she wants to know

Ms. Marlon is a new high school teacher. She wants to know what she can do to maximize her students' learning and achievement. Based on research, what can Kate do to establish a classroom climate most conducive to learni ...

Risk based monitoring central monitoring and analytics

Risk Based Monitoring, Central Monitoring and Analytics Paper (3-5 pages in length) Paper Scenario: You are a pharmaceutical project manager associated with a compound that is planned to have 4-5 co-occurring/overlapping ...

Question evaluate the evidence create a draft of the

Question: Evaluate the evidence. Create a draft of the findings of the articles you have selected and how they contribute to our knowledge of this problem. Be sure to address each of the following items in your draft: 1. ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As