Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

We must never lose sight that our personal feelings are just that personal not to be shared with our clients." Thanks Deborah, and along those lines, not only do clients sometimes make choices we don't agree with...they at times act on those toward us. One time, after seeing a client for several weeks, just as we were ending our session, a client told me that she had been (for years) going to bars and seeking out married men to have sex with....one time encounters. of course that was enough by itself but to add to that, she came across as the most reserved and "shy" person you would ever meet. Then there were times she would say things to me that in another context would considered be very flirtatious or worse. So, this obviously made me feel uncomfortable. I had to talk to her about those kinds of comments, and in fact it was a way to approach her issues around men and how she approaches men. If a client began making these sorts of comments, how would you approach the situation?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91419234
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment -need a 3-4 page review report on the

Assignment - Need a 3-4 page review report on the article. Explain or discuss with the idea of the articles In 3 points the idea (abstract, introduction), material and methods, result. Article - Pregnancy Alters Aflatoxi ...

Question one highlight in the life of a parent is when

Question: One highlight in the life of a parent is when their child says their first word. Soon after this celebratory event, language acquisition will accelerate faster than at any other time in life. For some hints on ...

These are just a few articles you can examine to begin your

These are just a few articles you can examine to begin your research. There are many more sources which highlight techniques and tactics, in addition to court filings and books. The above is simply a starting point for t ...

Question submit a 2- to 3-page apa formatted paper in which

Question: Submit a 2- to 3-page APA formatted paper in which you: Explain the potential impact of white privilege on clients from both dominant and minority groups (consider impact of both positive and negative stereotyp ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question create a 1200-1500-word safety plan for a client

Question: Create a 1,200-1,500-word safety plan for a client similar to Ted, who had been diagnosed with schizophrenia that addresses potential depression and suicidality. Include the following in your safety plan: 1. Wh ...

Question for your hot topic research essay you will explore

Question: For your Hot Topic Research Essay, you will explore the use of organic foods and adapting a menu to meet demand for organic foods. The essay will be demonstrate knowledge gained from this course, research, and ...

Enterprise mobile app business casewritten reportin this

ENTERPRISE MOBILE APP BUSINESS CASE WRITTEN REPORT In this assignment, you assume the role of the enterprise's CIO. As the CIO you are impressed with the concept of the app presented to you in Assignment 1 by the Manager ...

Question according to mead the last stage of development of

Question : According to Mead, the last stage of development of the self is when we are able to take on the attitudes and expectations of the broader social world (the generalized other). First explain the concept of the ...

Question in chapter 12 of your text there is a discussion

Question: In chapter 12 of your text there is a discussion of learning environments that are teacher-centered and those that are student-centered. (a) After reading that section explain what you think is the best approac ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As