Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

US Government Politics Assignment

Write a three to four page paper in which the student answers the following three items using headers to separate each item:

Discuss either two civil liberties or two civil rights events (past or current) that have influenced a sense of social responsibility in the American government today. Provide examples to support your answer. Note: In your response, consider how the events influenced the way state, local or national political leaders or agencies responded in a socially responsible or ethical manner toward the community.

Discuss two media events (past or present) that have positively and or negatively influenced the public's opinion of a government agency. Provide examples to support your answer. Note: Consider how a news story or media coverage of an event positively or negatively changed the public's opinion (or perception) regarding how responsible a government agency should be towards meeting the needs of its customers; i.e. the American people.

Discuss two differences between the Republican and Democratic parties that may have an ethical impact (positively or negatively) on the American people. Provide examples to support your answer. Note: Consider the different ideals, values, morals, and/or goals held by the Republican and Democratic parties, and their different views on the ethically or morally right way to govern and make the best policies for the people they serve. Determine if your example presents any type of ethical concerns for or against the public interest of the American people.

In your research, you cannot use Wikipedia, online dictionaries, Sparknotes, Cliffnotes, or any other Website do that does not qualify as an academic resource.

Your assignment must follow these formatting requirements:

Be typed, double spaced, using Times New Roman font (size 12), with one-inch margins on all sides; citations and references must follow APA or school-specific format. Check with your professor for any additional instructions.

Include a cover page containing the title of the assignment, the student's name, the professor's name, the course title, and the date. The cover page and the reference page are not included in the required assignment page length.

The specific course learning outcomes associated with this assignment are to:

Identify informed opinions on issues and questions involving the U.S. government, national political processes, policy making, and the notion of democracy.

Employ terminology used to study political science and American government.

Distinguish between civil rights and civil liberties in the context of Supreme Court protection of freedom of expression.

Develop reasoned written and spoken presentations on issues and questions involving the U.S. government and national political processes using information in the course.

Explain how the federal system of government works.

Explore different perspectives on issues and questions about the U.S. government and national political processes.

Describe the importance of an informed, effective citizenship for the national government and political processes.

Use technology and information resources to research issues in the field of U.S. government and politics.

Write clearly and concisely about U.S. government and politics using proper writing mechanics.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92030568
  • Price:- $35

Priced at Now at $35, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question self-assessment surveys and development of

Question: Self-Assessment Surveys and Development of Leadership Talent" Please respond to the following: • Debate the usefulness of self-assessment surveys to determine employees with high potential within the organizati ...

Question the text states hr td amp pi professionals need to

Question: The text states "HR, T+D & PI professionals need to transition away from being tactical specialist and move toward strategic generalist." Perform research to explain what each of the professions do and how they ...

Assignment 3 essay anxiety and attentionpart i compare and

Assignment 3: Essay: Anxiety and Attention Part I: Compare and contrast how the anxiety-performance relationship is explained by the individual zones of optimal functioning model, multidimensional anxiety theory, and cus ...

Assignment 1 discussion-cultural differences and ethical

Assignment 1: Discussion-Cultural Differences and Ethical Standards Your Module 3 readings explained that understanding cultural differences are critical to success in international business. A country's culture reflects ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

In the course you chose an every day contract to analyze

In the course, you chose an every day contract to analyze for this project. Your analysis should be 4 pages (typed double spaced) in length (cover pages and reference pages do not count towards the page count) and follow ...

Question 1 in the cdc statistics article which statistics

Question: 1) In the CDC Statistics article, which statistics were interesting to you or surprised you and why? (If none surprised you - explain why) 2) After reading the article (see text above), "When are you ready for ...

Question 1private capital expenditure for 12 successive

Question 1 Private capital expenditure for 12 successive quarters are presented in the following table: Quarter Millions     1 31,920 2 25,120 3 30,350 4 24,650 5 30,090 6 23,980 7 28,450 8 26,710 9 31,380 10 27,260 11 3 ...

Republican form of governmentthe framers of the

Republican form of Government The Framers of the Constitution were most concerned about making a government that would work well and would last. They were obsessed with a fear that the new government would end up being a ...

Question thomas from michigan decided to replace the two

Question: Thomas from Michigan decided to replace the two front tires on his truck because winter was approaching and they were beginning to look worn. He suspected that the tires probably could hold out longer, but want ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As